• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Veterinary Science
• /
• v.21 no.2
• /
• pp.22.1-22.9
• /
• 2020

Rabid raccoon dogs (Nyctereutes procyonoides koreensis) have been responsible for animal rabies in South Korea since the 1990s. A recombinant rabies vaccine strain, designated as ERAGS, was constructed for use as a bait vaccine. Therefore, new means of differentiating ERAGS from other rabies virus (RABV) strains will be required in biological manufacturing and diagnostic service centers. In this study, we designed two specific primer sets for differentiation between ERAGS and other RABVs based on mutation in the RABV glycoprotein gene. Polymerase chain reaction analysis of the glycoprotein gene revealed two DNA bands of 383 bp and 583 bp in the ERAGS strain but a single DNA band of 383 bp in the field strains. The detection limits of multiplex reverse transcription polymerase chain reaction (RT-PCR) were 80 and 8 FAID₅₀/reaction for the ERAGS and Evelyn-Rokitnicki-Abelseth strains, respectively. No cross-reactions were detected in the non-RABV reference viruses, including canine distemper virus, parvovirus, canine adenovirus type 1 and 2, and parainfluenza virus. The results of multiplex RT-PCR were 100% consistent with those of the fluorescent antibody test. Therefore, one-step multiplex RT-PCR is likely useful for differentiation between RABVs with and those without mutation at position 333 of the RABV glycoprotein gene.

• The Plant Pathology Journal
• /
• v.34 no.6
• /
• pp.490-498
• /
• 2018

Panicle blight and seed rot disease caused mainly by Burkholderia glumae and Burkholderia gladioli is threatening rice cultivation worldwide. The bacteria have been reported as seed-borne pathogens from rice. Accurate detection of both pathogens on the seeds is very important for limiting the disease dissemination. Novel primer pairs targeting specific molecular markers were developed for the robust detection of B. glumae and B. gladioli. The designed primers were specific in detecting the target species with no apparent cross-reactions with other related Burkholderia species at the expected product size. Both primer pairs displayed a high degree of sensitivity for detection of B. glumae and B. gladioli separately in monoplex PCR or simultaneously in duplex PCR from both extracted gDNA and directly preheated bacterial cell suspensions. Limit of detection was as low as 0.1 ng of gDNA of both species and $3.86{\times}10^2cells$ for B. glumae and $5.85{\times}10^2cells$ for B. gladioli. On inoculated rice seeds, the designed primers could separately or simultaneously detect B. glumae and B. gladioli with a detection limit as low as $1.86{\times}10^3cells$ per rice seed for B. glumae and $1.04{\times}10^4cells$ per rice seed of B. gladioli. The novel primers maybe valuable as a more sensitive, specific, and robust tool for the efficient simultaneous detection of B. glumae and B. gladioli on rice seeds, which is important in combating rice panicle blight and seed rot by early detection and confirmation of the dissemination of pathogen-free rice seeds.

• Journal of Veterinary Science
• /
• v.21 no.4
• /
• pp.63.1-63.9
• /
• 2020

Background: Canine adenovirus type 2 (CAV-2) induces infectious laryngotracheitis in members of the family Canidae, including dogs. To date, no ELISA kits specific for CAV-2 antibody have been commercialized for dogs in Korea. Objectives: We aimed to develop new indirect enzyme-linked immunosorbent assay (I-ELISA) to perform rapid, accurate serological surveys of CAV-2 in dog serum samples. Methods: In total, 165 serum samples were collected from dogs residing in Chungbuk and Gyeongbuk provinces between 2016 and 2018. The Korean CAV-2, named the APQA1701-40P strain, was propagated in Madin-Darby canine kidney cells and purified in an anion-exchange chromatography column for use as an antigen for I-ELISA. The virus-neutralizing antibody titers of CAV-2 in the dog sera were measured by virus neutralization (VN) test. Results: We compared the results obtained between the VN and new I-ELISA tests. The sensitivity, specificity, and accuracy of new I-ELISA were 98.6%, 86.4% and 97.0% compared with VN test, respectively. New I-ELISA was significantly correlated with VN (r = 0.91). Conclusions: These results indicate that new I-ELISA is useful for sero-surveillance of CAV-2 in dog serum.

• The Plant Pathology Journal
• /
• v.38 no.3
• /
• pp.182-193
• /
• 2022

Turfgrass, the most widely grown ornamental crop, is severely affected by fungal pathogens including Sclerotinia homoeocarpa, Rhizoctonia solani, and Magnaporthe poae. At present, turfgrass fungal disease management predominantly relies on synthetic fungicide treatments. However, the extensive application of fungicides to the soil increases residual detection frequency, raising concerns for the environment and human health. The bacterial volatile compound, 2,3-butanediol (BDO), was found to induce plant resistance. In this study, we evaluated the disease control efficacy of a combination of stereoisomers of 2,3-BDO and commercial fungicides against turfgrass fungal diseases in both growth room and fields. In the growth room experiment, the combination of 0.9% 2R,3R-BDO (levo) soluble liquid (SL) formulation and 9% 2R,3S-BDO (meso) SL with half concentration of fungicides significantly increased the disease control efficacy against dollar spot and summer patch disease when compared to the half concentration of fungicide alone. In field experiments, the disease control efficiency of levo 0.9% and meso 9% SL, in combination with a fungicide, was confirmed against dollar spot and large patch disease. Additionally, the induction of defense-related genes involved in the salicylic acid and jasmonic acid/ethylene signaling pathways and reactive oxygen species detoxification-related genes under Clarireedia sp. infection was confirmed with levo 0.9% and meso 9% SL treatment in creeping bentgrass. Our findings suggest that 2,3-BDO isomer formulations can be combined with chemical fungicides as a new integrated tool to control Clarireedia sp. infection in turfgrass, thereby reducing the use of chemical fungicides.

• The Plant Pathology Journal
• /
• v.31 no.1
• /
• pp.25-32
• /
• 2015

Pseudomonas coronafaciens causes halo blight on oats and is a plant quarantine bacterium in many countries, including the Republic of Korea. Using of the certificated seed is important for control of the disease. Since effective detection method of P. coronafaciens is not available yet, PCR and TaqMan PCR assays for specific detection of P. coronafaciens were developed in this study. PCR primers were designed from the draft genome sequence of P. coronafaciens LMG 5060 which was obtained by the next-generation sequencing in this study. The PCR primer set Pc-12-F/Pc-12-R specifically amplified 498 bp from the 13 strains of P. coronafaciens isolated in the seven different countries (Canada, Japan, United Kingdom, Zimbabwe, Kenya, Germany, and New Zealand) and the nested primer set Pc-12-ne-F/Pc-12-ne-R specifically amplified 298 bp from those strains. The target-size PCR product was not amplified from the non-target bacteria with the PCR and nested primer sets. TaqMan PCR with Pc-12-ne-F/Pc-12-ne-R and a TaqMan probe, Pc-taqman, which were designed inside of the nested PCR amplicon, generated Ct values which in a dose-dependent manner to the amount of the target DNA and the Ct values of all the P. coronafaciens strains were above the threshold Ct value for positive detection. The TaqMan PCR generated positive Ct values from the seed extracts of the artificially inoculated oat seeds above 10 cfu/ml inoculation level. PCR and TaqMan PCR assays developed in this study will be useful tools to detect and identify the plant quarantine pathogen, P. coronafaciens.

• Journal of Biosystems Engineering
• /
• v.33 no.6
• /
• pp.446-452
• /
• 2008

Machine vision system was used for analyzing leaf color disorders of tomato plants in a greenhouse. From the day when a few leave of tomato plants had started to wither, a series of images were captured by 4 times during 14 days. Among several color image spaces, Saturation frame in HSI color space was adequate to eliminate a background and Hue frame was good to detect infected disease area and tomato fruits. The processed image ($G{\sqcup}b^*$ image) by OR operation between G frame in RGB color space and $b^*$ frame in $La^*b^*$ color space was useful for image segmentation of a plant canopy area. This study calculated a ratio of the infected area to the plant canopy and manually analyzed leaf color disorders through an image segmentation for Hue frame of a tomato plant image. For automatically analyzing plant leave disease, this study selected twenty-seven color patches on the calibration bars as the corresponding to leaf color disorders. These selected color patches could represent 97% of the infected area analyzed by the manual method. Using only ten color patches among twenty-seven ones could represent over 85% of the infected area. This paper showed a proposed machine vision system may be effective for evaluating various leaf color disorders of plants growing in a greenhouse.

• Research in Plant Disease
• /
• v.18 no.2
• /
• pp.129-132
• /
• 2012

Citrus bacterial canker is an economically important disease affecting citrus production in many citrusgrowing areas and several pathotypes have been recognized within the Xanthomonas pathogens causing canker. In view of the containment of the disease, accurate identification of the causal bacterium is important. In this study, triplex PCR method was developed by using the previously reported primers. Two groups of primer combination, such as, one group including primers 2/3, J-pth1/J-pth2 and XACF/XACR, and another group 2/3, J-pth1/J-pth2 and Xac01/Xac02, were suitable for the detection and differentiation of X. a. pv. citri $A^w$, X. a. pv. aurantifolii B and C, and X. a. pv. citrumelo E strains. Moreover, the primer combination of Xac01 and J-pth2 promised us to use as a specific primer set to detect X. a. pv. citrumelo E strain. The PCR methods developed in this study could be used for the rapid differentiation of Xanthomonas pathotypes of citrus.

• Korean Journal of Veterinary Service
• /
• v.37 no.4
• /
• pp.263-271
• /
• 2014

In this study, we developed a cost and time saving one-step multiplex RT-PCR for the simultaneous detection and differentiation of swine influenza viruses (SIV) and 2009 pandemic influenza H1N1 virus (pH1N1). The one-step multiplex RT-PCR using four sets of primer was confirmed to be capable of detection of all SIV subtypes and differential diagnosis of major SIV subtype H1, H3 and pH1N1 on individual or mixed viral culture samples. The sensitivity of the multiplex RT-PCR was determined to be at least $2^{-6}$ $HA/25{\mu}L$ of the presented SIVs, providing sufficient efficacy for a routine SIV monitoring in diagnostic laboratories. In addition, compared with the conventional RT-PCR methods that cannot avoid the carryover DNA contamination, the developed RT-PCR applied with the uracil DNA glycosylase (UNG) system was proven to prevent a false positive reaction by carryover contamination of the pre-amplified DNA. In conclusion, the one-step RT-PCR with UNG system could be applicable to detect and differentiate of SIV from the viral cultures without worry of carryover DNA contamination in clinical laboratories.

• International Journal of Computer Science & Network Security
• /
• v.23 no.9
• /
• pp.77-90
• /
• 2023

Today, crops face many characteristics/diseases. Insect damage is one of the main characteristics/diseases. Insecticides are not always effective because they can be toxic to some birds. It will also disrupt the natural food chain for animals. A common practice of plant scientists is to visually assess plant damage (leaves, stems) due to disease based on the percentage of disease. Plants suffer from various diseases at any stage of their development. For farmers and agricultural professionals, disease management is a critical issue that requires immediate attention. It requires urgent diagnosis and preventive measures to maintain quality and minimize losses. Many researchers have provided plant disease detection techniques to support rapid disease diagnosis. In this review paper, we mainly focus on artificial intelligence (AI) technology, image processing technology (IP), deep learning technology (DL), vector machine (SVM) technology, the network Convergent neuronal (CNN) content Detailed description of the identification of different types of diseases in tomato and potato plants based on image retrieval technology (CBIR). It also includes the various types of diseases that typically exist in tomato and potato. Content-based Image Retrieval (CBIR) technologies should be used as a supplementary tool to enhance search accuracy by encouraging you to access collections of extra knowledge so that it can be useful. CBIR systems mainly use colour, form, and texture as core features, such that they work on the first level of the lowest level. This is the most sophisticated methods used to diagnose diseases of tomato plants.