• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• Journal of Plant Biology
• /
• 제34권4호
• /
• pp.331-339
• /
• 1991

To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.

• Journal of Plant Biology
• /
• 제38권3호
• /
• pp.259-266
• /
• 1995

To investigate how the dyad symmetry region (DSR) and the distance between vir box and -35 sequence of the virE promoter plays a role in virE gene expression, two mutants were constructed by base substitution and insertional mutagenesis. The base substitutional mutation, a AAlongrightarrowCG substitution at positions -39 and -40 on the DSR, showed the level of $\beta$-galactosidase activity approximately 91% of the wild type virE promoter activity. Therefore, the native structure of the DSR seems to be not essential for virE expression. The insertional mutation, constructed by inserting 8 bp ClaI linker between -49 and -50, displayed the $\beta$-galactosidase activity at 12% of the native virE promoter activity. However, this striking reduction appears to be not caused by destruction of the native DSR structure, but by shifting the vir box far from putative -35 sequence.

• Journal of Microbiology
• /
• 제37권3호
• /
• pp.175-179
• /
• 1999

To elucidate the role of vir-box in the expression of the virE gene, the vir-box was modified by site-directed mutagenesis and tested for ${\beta}$-galactosidase activities. A, C, T T, A, C substitutions at -62, -63, and -65 positions, destroying the 5'-region of the vir-box and A T at position -55, destroying the 3'-region of the vir-box respectively, showed only 17% promoter activity. When the vir-box was modified to contain perfect dyad symmetry structure (DSR) by the substitutions T, G A, T at -60 an d-61 positions, ${\beta}$-glactosidase activity increased 302%. These results indicate that the 5' and 3'-region of vir-box as well as the imperfect DSR of the vir-box itself may play a very important role in the regulation of virE gene expression.

• 한국동물학회:학술대회논문집
• /
• 한국동물학회 1994년도 한국생물과학협회 학술발표대회
• /
• pp.247.2-247
• /
• 1994

No Abstract, See Full Text

• 한국동물학회:학술대회논문집
• /
• 한국동물학회 1996년도 한국생물과학협회 국제학술대회
• /
• pp.231.1-231
• /
• 1996

No Abstract, See Full Text