Journal of Plant Biology
- Volume 35 Issue 2
- /
- Pages.155-163
- /
- 1992
- /
- 1226-9239(pISSN)
Structural Characterization of the Regulatory Site in virE Promoter of Agrobacterium tumefaciens pTiA6 Plasmid
Agrobacterium tumefaciens pTiA6 플라스미드의 virE 프로모터내 조절부위의 구조적 특성
Abstract
To elucidate the regulatory mechanism of virE operon in Agrobacterium tumefaciens pTiA6 plasmid at the molecular level, the regulatory site of virE promoter was determined using truncated virE recombinant plasmids obtained by 5' deletion analysis of virE promoter. The size of deleted nucleotides of p]S201, a functional recombinant plasmid, was found to be about 130 nucleotides from 5'-end of virE promoter. On the other hand the size of deleted nucleotides of p]S301, nonfunctional recombinant plasmid, was identified 263 nucleotides by DNA sequencing. Hence it was thought that the essential site of virE promoter was located between about 130th nucleotide and 263th nucleotide. Since the inverted repeat sequence (AACTTTGCGCTATAGGCAMGTT) is included in this essential site of virE promoter, it could be the first recognition site of the RNA polymerase in virE promoter.omoter.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
Keywords