• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• Journal of Plant Biology
• /
• 제34권4호
• /
• pp.331-339
• /
• 1991

To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.

• Journal of Microbiology
• /
• 제33권2호
• /
• pp.165-170
• /
• 1995

The 356 amino acid long lambda integrase protein of bacteriophage .lambda. constains two autonomous DNA binding domains with distinct sequence specificities. The amino terminal domain of integrase is implicated to bind to the arm-type sequences and the carboxyl domain interacts with the coretype sequencess. As a first step to understand the molecular mechanism of the integrase-DNA interaction at the arm-type site, the int(am)94 gene carrying an amber mutation at the 94th codon of the int was cloned under the control of the P$\_$tac/ promoter and the lacI$\_$q/ gene. The Int(am)94 mutant protein of amino terminal 93 amino acid residues can be produced at high level from a suppressor free strain harboring the plasmid pInt(am)94. The arm-type binding activity of Int(am)94 were measured in vivo and in vitro. A comparison of the arm-type binding properties of the wild-type integrase and the truncated Int(am)94 mutant indicated that the truncated fragment containing 93 amino acid residues carry all the determinants for DNA binding at the arm-type sites.

• Journal of Microbiology and Biotechnology
• /
• 제30권11호
• /
• pp.1777-1784
• /
• 2020

To increase the availability of microalgae as producers of valuable compounds, it is necessary to develop novel systems for gene expression regulation. Among the diverse expression systems available in microalgae, none are designed to induce expression by low temperature. In this study, we explored a cold-inducible system using the antifreeze protein (AFP) promoter from a polar diatom, Chaetoceros neogracile. A vector containing the CnAFP promoter (pCnAFP) was generated to regulate nuclear gene expression, and reporter genes (Gaussia luciferase (GLuc) and mVenus fluorescent protein (mVenus)) were successfully expressed in the model microalga, Chlamydomonas reinhardtii. In particular, under the control of pCnAFP, the expression of these genes was increased at low temperature, unlike pAR1, a promoter that is widely used for gene expression in C. reinhardtii. Promoter truncation assays showed that cold inducibility was still present even when pCnAFP was shortened to 600 bp, indicating the presence of a low-temperature response element between -600 and -477 bp. Our results show the availability of new heterologous gene expression systems with cold-inducible promoters and the possibility to find novel low-temperature response factors in microalgae. Through further improvement, this cold-inducible promoter could be used to develop more efficient expression tools.

• 한국미생물·생명공학회지
• /
• 제24권3호
• /
• pp.290-298
• /
• 1996

In an effort to understand the role of the conserved domain and of the heterologous one-third part of the carboxy terminal domain of transglutaminase C (TGase II), attempts were made to express TGase II cDNA of human origin in yeast Saccharomyces cerevisiae as in a full-length form as well as in a form of C-terminal truncation. The 2$\mu$-based expression plasmids which contained the TGase II cDNA under the gal inducible promoter were introduced into yeast and the maintenance of the full-length and truncated form of the TGase II gene plasmids were confirmed by Southern blot. The expression of the TGase II gene was analysed by reverse transcription polymerase chain reaction (RT-PCR), and western blot analyses. As assayed by [1,4$^{14}$C]-putrescine incorporation into succinylated casein, the full-lenth as well as the truncated forms of recombinant TGase II showed some catalytic activity. These results indicate that the N-terminal homologous domain of human TGase II retains a catalytically active domain. The level of TGase II expressed in yeast, however, was far lower than satisfactory and other expression system should be sought further chracterization of the enzyme. The negative effect of TGase II on the growth of yeast is interesting with respect to the physiological effect of TGase II in cornification of epidermal keratinocytes.

• Korean Chemical Engineering Research
• /
• 제58권2호
• /
• pp.280-285
• /
• 2020

We have developed a constitutive display system of the Pseudomonas fluorescens SIK W1 TliA lipase on the cell surface of Escherichia coli using E. coli outer membrane protein C (OmpC) as an anchoring motif, which is an economical compared to induced system. For the constitutive expression of truncated OmpC-TliA fusion proteins, gntT104 promoter was employed. Cell growth was not affected by over expression of fusion protein during entire culture time, suggesting cell lysis was not a problem. The localization of truncated OmpC-TliA fusion protein on the cell surface was confirmed by immunofluorescence microscopy and measuring whole cell lipase activity. Constitutively displayed lipase was very stable, retaining activity enantioselectivity throughout the five repeated reactions. These results suggest that OmpC from E. coli be a useful anchoring motif for displaying enzymes on the cell surface without any inducers, and this stable surface display system can be employed for a broad range of biotechnological applications.

• Journal of Microbiology and Biotechnology
• /
• 제2권2호
• /
• pp.115-121
• /
• 1992

In order to broaden the spectrum of substrate utilization of a Gram negative bacterium Zymomonas mobilis which has a great potential as an industrial ethanol producing microorganism, cloning of $\alpha$-amylase gene into Z. mobilis ZM4 was tried. The $\alpha$-amylase gene was isolated from Bacillus stearothermophilus. By Southern blot analysis, it was proven that the $\alpha$-amylase gene fragment was originated from a naturally occuring plasmid of B. stearothermophilus ATCC 31195. To place $\alpha$-amylase gene under the control of Z. mobilis promoter, two different Z. mobilis expression vectors, pZA26 and pLOI204, were used. The truncated $\alpha$-amylase gene was then introduced into these vectors. Both qualitative and quantitative activities of $\alpha$-amylase were observed in Z. mobilis cells harboring these plasmids with the $\alpha$-amylase gene inserted. Gas chromatographic analysis of ethanol showed that one of the Z. mobilis transconjugants was capable of producing 67 mM ethanol from rich medium(RM) containing 5% soluble starch as a sole carbon source.

• International Journal of Industrial Entomology and Biomaterials
• /
• 제37권2호
• /
• pp.49-54
• /
• 2018

To artificially enhance antimicrobial peptide expression in Bombyx mori, we constructed genetically engineered silkworms overexpressing Rel family transcription factor. The truncated BmRelish1 (BmRelish1t) gene contained a Rel homolog domain (RHD), nuclear localization signal (NLS), acidic and hydrophobic amino acid (AHAA)-rich region, and death domain (DD), but no ankyrin-repeat (ANK) domain. The BmRelish1t gene was controlled by B. mori cytoplasmic actin 3 promoter in the PiggyBac transposon vector. Chromosome analysis of G1 generations of a transgenic silkworm with EGFP expression confirmed stable insertion of BmRelish1t. BmRelish1t gene overexpression in transgenic silkworms resulted in higher mRNA expression levels of B. mori antimicrobial peptides such as lebocin(~20.5-fold), moricin(~8.7-fold), and nuecin(~17.4-fold) than those in normal silkworms.

• 한국균학회소식:학술대회논문집
• /
• 한국균학회 2016년도 춘계학술대회 및 임시총회
• /
• pp.27-27
• /
• 2016

The ascomycete fungus Fusarium graminearum is the most common pathogen of Fusarium head blight (FHB), a devastating disease for major cereal crops worldwide. FHB causes significant crop losses by reducing grain yield and quality as well as contaminating cereals with trichothecenes and zearalenone (ZEA) that pose a serious threat to animal health and food safety. ZEA is a causative agent of hyperestrogenic syndrome in mammals and can result in reproductive disorders in farm animals. In F. graminearum, the ZEA biosynthetic cluster is composed of four genes, PKS4, PKS13, ZEB1, and ZEB2, which encode a reducing polyketide synthase, a nonreducing polyketide synthase, an isoamyl alcohol oxidase, and a transcription factor, respectively. Although it is known that ZEB2 primarily acts as a regulator of ZEA biosynthetic cluster genes, the mechanism underlying this regulation remains undetermined. In this study, two isoforms (ZEB2L and ZEB2S) from the ZEB2 gene in F. graminearum were characterized. It was revealed that ZEB2L contains a basic leucine zipper (bZIP) DNA-binding domain at the N-terminus, whereas ZEB2S is an N-terminally truncated form of ZEB2L that lacks the bZIP domain. Interestingly, ZEA triggered the induction of both ZEB2L and ZEB2S transcription. In ZEA producing condition, the expression of ZEB2S transcripts via alternative promoter usage was directly or indirectly initiated by ZEA. Physical interaction between ZEB2L and ZEB2L as well as between ZEB2L and ZEB2S was observed in the nucleus. The ZEB2S-ZEB2S interaction was detected in both the cytosol and the nucleus. ZEB2L-ZEB2L oligomers activated ZEA biosynthetic cluster genes, including ZEB2L. ZEB2S inhibited ZEB2L transcription by forming ZEB2L-ZEB2S heterodimers, which reduced the DNA-binding activity of ZEB2L. This study provides insight into the autoregulation of ZEB2 expression by alternative promoter usage and a feedback loop during ZEA production.

• Journal of Microbiology
• /
• 제41권3호
• /
• pp.259-261
• /
• 2003

The nsdD gene has been predicted to encode a GATA type transcription factor with the type IVb zinc finger DNA binding domain functions in activating sexual development of A. nidulans. In several allelic mutants of nsdD producing truncated NsdD polypeptides lacking the C-terminal zinc finger, the transcription level of nsdD gene was greatly increased. Also in an over-expressed mutant, the transcription under its own promoter was reduced. These results suggest that the expression of nsdD is negatively autoregulated. When the nsdD gene was over-expressed, cleistothecia were formed in excess amounts even in the presence of 0.6 M KC1 that inhibited sexual development of the wild type. Northern blot analysis revealed that the expression of nsdD was repressed by 0.6 M KC1. These results strongly suggest that the inhibition of sexual development by salts was carried out via the nsdD involved regulatory network.