식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.
The 356 amino acid long lambda integrase protein of bacteriophage .lambda. constains two autonomous DNA binding domains with distinct sequence specificities. The amino terminal domain of integrase is implicated to bind to the arm-type sequences and the carboxyl domain interacts with the coretype sequencess. As a first step to understand the molecular mechanism of the integrase-DNA interaction at the arm-type site, the int(am)94 gene carrying an amber mutation at the 94th codon of the int was cloned under the control of the P$\_$tac/ promoter and the lacI$\_$q/ gene. The Int(am)94 mutant protein of amino terminal 93 amino acid residues can be produced at high level from a suppressor free strain harboring the plasmid pInt(am)94. The arm-type binding activity of Int(am)94 were measured in vivo and in vitro. A comparison of the arm-type binding properties of the wild-type integrase and the truncated Int(am)94 mutant indicated that the truncated fragment containing 93 amino acid residues carry all the determinants for DNA binding at the arm-type sites.
Kim, Minjae;Kim, Jongrae;Kim, Sanghee;Jin, EonSeon
Journal of Microbiology and Biotechnology
/
제30권11호
/
pp.1777-1784
/
2020
To increase the availability of microalgae as producers of valuable compounds, it is necessary to develop novel systems for gene expression regulation. Among the diverse expression systems available in microalgae, none are designed to induce expression by low temperature. In this study, we explored a cold-inducible system using the antifreeze protein (AFP) promoter from a polar diatom, Chaetoceros neogracile. A vector containing the CnAFP promoter (pCnAFP) was generated to regulate nuclear gene expression, and reporter genes (Gaussia luciferase (GLuc) and mVenus fluorescent protein (mVenus)) were successfully expressed in the model microalga, Chlamydomonas reinhardtii. In particular, under the control of pCnAFP, the expression of these genes was increased at low temperature, unlike pAR1, a promoter that is widely used for gene expression in C. reinhardtii. Promoter truncation assays showed that cold inducibility was still present even when pCnAFP was shortened to 600 bp, indicating the presence of a low-temperature response element between -600 and -477 bp. Our results show the availability of new heterologous gene expression systems with cold-inducible promoters and the possibility to find novel low-temperature response factors in microalgae. Through further improvement, this cold-inducible promoter could be used to develop more efficient expression tools.
In an effort to understand the role of the conserved domain and of the heterologous one-third part of the carboxy terminal domain of transglutaminase C (TGase II), attempts were made to express TGase II cDNA of human origin in yeast Saccharomyces cerevisiae as in a full-length form as well as in a form of C-terminal truncation. The 2$\mu$-based expression plasmids which contained the TGase II cDNA under the gal inducible promoter were introduced into yeast and the maintenance of the full-length and truncated form of the TGase II gene plasmids were confirmed by Southern blot. The expression of the TGase II gene was analysed by reverse transcription polymerase chain reaction (RT-PCR), and western blot analyses. As assayed by [1,4$^{14}$C]-putrescine incorporation into succinylated casein, the full-lenth as well as the truncated forms of recombinant TGase II showed some catalytic activity. These results indicate that the N-terminal homologous domain of human TGase II retains a catalytically active domain. The level of TGase II expressed in yeast, however, was far lower than satisfactory and other expression system should be sought further chracterization of the enzyme. The negative effect of TGase II on the growth of yeast is interesting with respect to the physiological effect of TGase II in cornification of epidermal keratinocytes.
We have developed a constitutive display system of the Pseudomonas fluorescens SIK W1 TliA lipase on the cell surface of Escherichia coli using E. coli outer membrane protein C (OmpC) as an anchoring motif, which is an economical compared to induced system. For the constitutive expression of truncated OmpC-TliA fusion proteins, gntT104 promoter was employed. Cell growth was not affected by over expression of fusion protein during entire culture time, suggesting cell lysis was not a problem. The localization of truncated OmpC-TliA fusion protein on the cell surface was confirmed by immunofluorescence microscopy and measuring whole cell lipase activity. Constitutively displayed lipase was very stable, retaining activity enantioselectivity throughout the five repeated reactions. These results suggest that OmpC from E. coli be a useful anchoring motif for displaying enzymes on the cell surface without any inducers, and this stable surface display system can be employed for a broad range of biotechnological applications.
In order to broaden the spectrum of substrate utilization of a Gram negative bacterium Zymomonas mobilis which has a great potential as an industrial ethanol producing microorganism, cloning of $\alpha$-amylase gene into Z. mobilis ZM4 was tried. The $\alpha$-amylase gene was isolated from Bacillus stearothermophilus. By Southern blot analysis, it was proven that the $\alpha$-amylase gene fragment was originated from a naturally occuring plasmid of B. stearothermophilus ATCC 31195. To place $\alpha$-amylase gene under the control of Z. mobilis promoter, two different Z. mobilis expression vectors, pZA26 and pLOI204, were used. The truncated $\alpha$-amylase gene was then introduced into these vectors. Both qualitative and quantitative activities of $\alpha$-amylase were observed in Z. mobilis cells harboring these plasmids with the $\alpha$-amylase gene inserted. Gas chromatographic analysis of ethanol showed that one of the Z. mobilis transconjugants was capable of producing 67 mM ethanol from rich medium(RM) containing 5% soluble starch as a sole carbon source.
Kim, Seong-Wan;Kim, Seong-Ryul;Goo, Tae-Won;Choi, Kwang-Ho
International Journal of Industrial Entomology and Biomaterials
/
제37권2호
/
pp.49-54
/
2018
To artificially enhance antimicrobial peptide expression in Bombyx mori, we constructed genetically engineered silkworms overexpressing Rel family transcription factor. The truncated BmRelish1 (BmRelish1t) gene contained a Rel homolog domain (RHD), nuclear localization signal (NLS), acidic and hydrophobic amino acid (AHAA)-rich region, and death domain (DD), but no ankyrin-repeat (ANK) domain. The BmRelish1t gene was controlled by B. mori cytoplasmic actin 3 promoter in the PiggyBac transposon vector. Chromosome analysis of G1 generations of a transgenic silkworm with EGFP expression confirmed stable insertion of BmRelish1t. BmRelish1t gene overexpression in transgenic silkworms resulted in higher mRNA expression levels of B. mori antimicrobial peptides such as lebocin(~20.5-fold), moricin(~8.7-fold), and nuecin(~17.4-fold) than those in normal silkworms.
The ascomycete fungus Fusarium graminearum is the most common pathogen of Fusarium head blight (FHB), a devastating disease for major cereal crops worldwide. FHB causes significant crop losses by reducing grain yield and quality as well as contaminating cereals with trichothecenes and zearalenone (ZEA) that pose a serious threat to animal health and food safety. ZEA is a causative agent of hyperestrogenic syndrome in mammals and can result in reproductive disorders in farm animals. In F. graminearum, the ZEA biosynthetic cluster is composed of four genes, PKS4, PKS13, ZEB1, and ZEB2, which encode a reducing polyketide synthase, a nonreducing polyketide synthase, an isoamyl alcohol oxidase, and a transcription factor, respectively. Although it is known that ZEB2 primarily acts as a regulator of ZEA biosynthetic cluster genes, the mechanism underlying this regulation remains undetermined. In this study, two isoforms (ZEB2L and ZEB2S) from the ZEB2 gene in F. graminearum were characterized. It was revealed that ZEB2L contains a basic leucine zipper (bZIP) DNA-binding domain at the N-terminus, whereas ZEB2S is an N-terminally truncated form of ZEB2L that lacks the bZIP domain. Interestingly, ZEA triggered the induction of both ZEB2L and ZEB2S transcription. In ZEA producing condition, the expression of ZEB2S transcripts via alternative promoter usage was directly or indirectly initiated by ZEA. Physical interaction between ZEB2L and ZEB2L as well as between ZEB2L and ZEB2S was observed in the nucleus. The ZEB2S-ZEB2S interaction was detected in both the cytosol and the nucleus. ZEB2L-ZEB2L oligomers activated ZEA biosynthetic cluster genes, including ZEB2L. ZEB2S inhibited ZEB2L transcription by forming ZEB2L-ZEB2S heterodimers, which reduced the DNA-binding activity of ZEB2L. This study provides insight into the autoregulation of ZEB2 expression by alternative promoter usage and a feedback loop during ZEA production.
The nsdD gene has been predicted to encode a GATA type transcription factor with the type IVb zinc finger DNA binding domain functions in activating sexual development of A. nidulans. In several allelic mutants of nsdD producing truncated NsdD polypeptides lacking the C-terminal zinc finger, the transcription level of nsdD gene was greatly increased. Also in an over-expressed mutant, the transcription under its own promoter was reduced. These results suggest that the expression of nsdD is negatively autoregulated. When the nsdD gene was over-expressed, cleistothecia were formed in excess amounts even in the presence of 0.6 M KC1 that inhibited sexual development of the wild type. Northern blot analysis revealed that the expression of nsdD was repressed by 0.6 M KC1. These results strongly suggest that the inhibition of sexual development by salts was carried out via the nsdD involved regulatory network.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.