본 연구에서는 GALl, GALl, GALlO 및 GAP promoter 하류에 reporter 유전자인 K. marxianus의 inulinase 유전자(lNUl)를 연결하여 각각의 재조합 plasmid들을 구축하고, 이들로 형질전환된 S. cerevrswe를 회분배양(YPOG 배지 )하여 외래 유전자 발현에 미치는 promoter의 영향을 비교.검토하 였다. 재조합 효모의 최종 균체농도는 36-39 00600 값을 보여 promoter에 따른 큰 차이를 보이지 않았으나, 포도당 소모기간 동안 비증식속도는 평균 $0.24 h^{-1}$로 유지되다가 galactose 소모기간 동안에 GAL promoter 함유 효모배양의 경우 $0.04-0.06 h^{-1}$, pYIGP 함유 재조합 효모배양은 $0.10 h^{-1}$로 감소하였다. 포도당 고갈 후 inulinase 발현은 시작되었고 균체외 inulinase의 발현 수준은 배양 72시간에 4.3 (GALl promoter), 4.0 (GAL7 promoter), 3.8 (GAL10 promoter) 및 1.6 (GAP promoter) unit/mL에 도달하였다. 평판배지상에서의 활성염색과 회분배양의 결과(최종발현양 및 초기 inulinase 말현속도), inulinase 발현에 미치는 promoter 세기 는 GALl > GALlO > GAL7 > GAP 순임을 알 수 있었다. GAL promoter가 배양말기까지 78 % 이상의 높은 plasmid 안정성을 보인 반면에, GAP promoter의 경우 55%의 낮은 plasmid 안정성을 보였다. 또한, 재조합 inulinase는 promoter 종류에 상관없이 98% 이상 배양액으로 분비되였다.
알카리 내성 Bacillus sp. YA-14의 chromosomal DNA로 부터 유래된 promoter를 subcloning하여 그 생화학적 특성과 포자형성과의 관계를 조사하였다. 알카리내성 Bacillus sp.와 B.subtilis에서 promoter의 활성은 포자가 형성되기 시작하는 단계에서 증가하기 시작했다. 또한 배지내 glucose가 1.0(w/v) 첨가시 promoter 활성이 억제되었다. 5가지의 spoO 유전자 중에서 3가지 유전자 (spoOB, spoOH, spoOJ) 산물이 promoter 활성에 필요하다.
B형간염바이러스(HBV)의 만성 감염은 간경화와 간세포암 발생 빈도를 현저히 높인다. HBV 감염의 임상적 결과는 숙주 유전적 요인과 바이러스의 유전자 변이, 그리고 환경적 요인 등에 결정된다. HBV 복제를 위한 HBV의 pre-genomic RNA 전사는 바이러스의 core promoter 활성화에 의해 조절된다. Core promoter 돌연변이는 급성간 질환과 간세포암 발생에 연관되어 있다. 본 연구팀은 미얀마의 HBV 감염 환자들로부터 바이러스 유전자를 획득하여 core promoter 부위의 유전자 변이들을 파악하였다. Core promoter의 상대적 유전자 활성 차이를 분석하기 위해서 core promoter를 luciferase reporter에 재조합한 시스템을 제작하였다. 분석한 core promoter의 유전자 변이들 중에서 C1731T와 G1806A 돌연변이가 HBV core promoter의 전사 활성화를 증가에 관여하였다. 돌연변이 부위를 중심으로 전사 인자들의 가능한 결합 부위 변화를 컴퓨터 프로그램 분석을 통해 조사한 결과, C/EBPβ와 XBP1 반응 부위가 새롭게 생성되었음을 도출하였다. C/EBPβ의 세포 내 발현은 C1713T 돌연변이를 가진 core promoter의 전사 활성을 증가시켰으며, XBP1 발현은 G1806A 돌연변이를 함유한 M95 promoter를 활성을 증가시켰다. HBV 감염의 치료는 약제 내성과 백신 회피 돌연변이 발생으로 문제점을 가지고 있는 상황에서, 이 연구 결과는 HBV core promoter 돌연변이의 분자생물학적 그리고 임상학적 중요성을 제공한다.
Nopaline synthase promoter의 upstream element region을 본딴 nos-RP 요소라고 불리워진 합성 oligomer는 nos wild type promotor의 5' end에서부터 - 101까지를 절단한 promoter의 upstream에 삽입하였다. Nos promoter의 활성은 nos promoter와 연결되어 있는 reporter gene인 Chlorarnphenicol과 $\beta$-glucuronidase유전 인자들이 발현되는 현상을 연구함으로써 측정하였다. 형질 전환된 유전인자를 가지고 있는 담배 식물에 대한 분석은 nos minimal promoter의 활성이 합성 nos-RP 요소가 삽입됨으로써 회복될 수 있음을 보여 주었다. 또한 Nos minimal promoter의 upstream에 nos-RP 요소의 삽입은 여러 가지 환경적인 요소들인 auxin, dithiothreitol, salicylic acid 그리고 methyl jasmonate에 의해서 활성이 증가됨을 보여 주었다.
Strong promoter로 밝혀진 alginate lyase 유전자의 promoter 부위에 대한 특성을 검토하기 위해 alginate lyase 유전자의 46개 N-terminal amino acid가 포함된 promoter 부분과, 같은 균으로부터 분리한 $\beta$-agarase의 유전자를 연결시켜 agarase의 activity를 평판배지상에서 보다 쉽게 확인하는 방법으로 promoter의 활성을 측정한 결과 alginate lyase 유전자 promoter에 의해서 $\beta$-agarase 유전자의 대량발현이 유도되고 있었으며 glucose의 존재하에서 $\beta$-agarase 유전자 발현이 일어나지 않는 catabolite repression 양상을 나타내고 있다. PCR로써 alginate lyase의 46개 N-terminal amino acid 부분이 순차적으로 제거된 plasmid를 제조하여 대량발현을 조사한 결과 46개의 아미노산이 제거된 후에도 $\beta$-agarase의 활성에는 변화가 없어 46개의 N-말단이 정상적인 상태에서 발현에는 영향을 미치고 있지 않음을 확인할 수 있었다. 또한 alginate lyase 유전자의 promoter region에 존재하는 가능한 2개의 promoter consensus sequence PI, PII를 subcloning한 결과 promoter PII만이 존재할 때도 대량발현이 유도되고 있음을 확인할 수 있었으며 동시에 glucose가 존재할 때 catabolite repression이 역시 나타나고 있어 이 부분이 발현 및 glucose에 의한 regulation에 매우 중요하게 작용하는 부분이라는 것을 확인할 수 있었다.
The nar promoter of Escherichia coli was known to induce maximally under anaerobic or microaerobic conditions in the presence of nitrate. In this study, the nar promoter was tested to see whether the expression level of a reporter gene which fused lacZ gene at nar promoter's downstream, in the some gram negative host strains(Agrobacterium, Pseudomonas and Rhizobium). A nar promoter system(Combination of nar promoter and gram negative strain) was grown under aerobic conditions to absorbance at 600 nm of nearly 2.0 and then, the nar promoter was induced by lowering DO to 1-2% with alternating microaerobic and aerobic condition in the fermentor cultures, using different gram negative hosts. For a wild type nar promoter (pNW61), it was possible to maintain production of ${\beta}-galactosidase$ activity per cell(specific ${\beta}-galactosidase$ activity) at 14,000, 9600, 45 Miller units in the presence of 1% nitrate. and for a nitrate - independent nar promoter (pNW618) at 12,000, 10,400 and 58 Miller units in the absence of nitrate ion, respectively.
The strength and regulatory characteristics of the heat-inducible HSA1, HSA2 and TPS1 promoters were compared with those of the well-established, carbon source-regulated FMD promoter in a Hansenula polymorpha-based host system in vivo. In addition, the Saccharomyces cerevisiae-derived ADH1 promoter was analysed. While ADH1 promoter showed to be of poor activity in the foreign host, the strength of the heat shock TPS1 promoter was found to exceed that of the FMD promoter, which at present is considered to be the strongest promoter for driving heterologous gene expression in H. polymorpha.
Klyyveromyces marxianus exoinulinase를 Saccharomyces cerevisiae에서 구성적으로 과발현 생산하기 위해, 구성적 promoter인 GAPDH, ADH1, PGK 및 ENOI promoters 하류에 exoinulinase 유전자 (INUI)의 ORF를 in frame으로 연결한 각각의 plasmi에 YIGP, pADHI,-INU, pPGK-INU 및 pENO-INU 를 구축하였다. 이들 각 plasmid를함유한 형질전환주 4종을 포도당 농도 5% 배지에서 회분배양한 결과 균체증식은 promoter에 따라 큰 차이를 보이지 않았지만 exoinulinase 발현수준과 plasmid 안정성은 사용한 promoter 에 크게 좌우되었다. 즉 exoinulinase 발현수준은 GAPDH PGK ADH1 ENO1 promoter 각각 1.70, 1.67 1.29, 0.80 unit/ml 였으며 plasmid 안정성은 GAPDH promoter 계의 55%를 제외하고 모두 80%이상으로 높게 나타났다. 이상의 plasmid 안정성과 exoinulinae 발현수준을 고려하여 ADH1 및 PGK 발현계를 선정하여 유가배양하였다 Yeast extract와 포도당을 간헐적으로 공급한 유가배양 결과, 두 발현계에서 약 30 g-DCW/1의 균체농도를 얻었지만, ADHI promoter 계에서는 3.70 unit/ml 의 최대 exoinulinase 활성과 96%의 plasmid 안정성을 보여TRh 반면에 PGK promoter 계는 각각 2.70 unit/ml/와 80%를 나타내었다. 따라서 plasmid 안정성과 긴 배양시간을 고려할 때 비선택적 영양배지를 사용하는 고농도세포 유가배양에서 ADH1 promoter가 exoinulinase 의 구성적 과발현, 생산에 더 적합할 것으로 사료된다.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.