• Journal of Plant Biology
• /
• 제34권4호
• /
• pp.331-339
• /
• 1991

To elucidate the regulatory mechanism of virE operon from vir regions (virA, virB, virC, virD, virG, virE) of pTiA6 which have been known to be essential for efficient crown gall tumorigenesis in plants, the activity of the truncated virE, promoter was analyzed. pSM358cd, a recombinant plasmid in which virE :: Tn3-HoHo1 (Tn3-promoterless lacZ) was cloned into SalI site of pVK102, was digested with SalI, and virE :: Tn3-HoHo1 was seperated from pVK102. To construct the truncted virE recombinant plasmids (pJS031, pJS051, pJS102, pJS201, pJS301), 5'-end of vireE promoter was deleted with BAL31 and cloned into pVK102 and then transferred into a. tumefaciens A348(pTiA6). According to the activity of the truncated virE promoter in recombinant plasmids, they were classified into two groups, pJS031, pJS051, pJS101 and pJS201 belong to a functional group and pJS301 is a non-functional. The size of deleted nucleotides of pJS201 and pJS301 seemed to be about 130 nucleotides and about 250 nucleotides from 5'-end of virE promoter, respectively. Hence it was thought that the essential site of the virE promoter was located between about 130th nucleotide and 250th nucleotide from 5'-end of the virE promoter.

• 한국자원식물학회지
• /
• 제13권1호
• /
• pp.11-17
• /
• 2000

우리 나라의 남부지방에서 고품질의 참당귀를 생산하고자 비가림하우스를 이용하여 차광재배로 하고현상을 방지한 후 멀칭재배을 실시하여 시험을 실시한 결과는 다음과 같다. 1. 멀칭 종류별 토양의 습도와 지온은 무멀칭보다 멀칭재배에서 높았고, 특히 멀칭 중에서도 P. E.(polyethylene) 멀칭이 가장 높았다. 2 잡초의 발생은 멀칭 종류별 검정 P. E. 멀칭재배에서 가장 적게 발생되었고, 투명 P E.멀칭재배에서는 많이 발생 되었다. 3. 생육은 P E. 멀칭재배가 짚멀칭이나 무멀칭보다 엽수가 많고 엽장이 커서 양호하였다. 4. 추대는 2∼5% 정도가 발생되었으며, P. E. 멀칭재배에서 약간 많이 발생되는 경향이었다. 5. 수량은 P E. 멀칭재배가 토양의 물리성이 좋아서 근수가 많고, 근장과 묘두직경이 커서 뿌리 생장이 양호하여 증수되었다. 한편, 검정 P E. 멀칭재배는 잡초 발생의 억제 효과가 뚜렷하여 P E. 멀칭재배시 노동력이 부족할 경우 적극 권장할 만한 멀칭재료로 생각되어진다.

• 한국자원식물학회지
• /
• 제13권2호
• /
• pp.124-130
• /
• 2000

우리 나라의 남부지방에서 고품질의 참당귀를 생산하고자 비가림하우스를 이용하여 차광재배로 하고현상을 방지한 후 멀칭재배을 실시하여 시험을 실시한 결과는 다음과 같다. 1 멀칭 종류별 토양의 습도와 지온은 무멀칭보다 멀칭재배에서 높았고, 특히 멀칭 중에서도 P. E.(polyethylene) 멀칭이 가장 높았다. 2. 잡초의 발생은 멀칭 종류별 투명 P. E. 멀칭재배에서 가장 적게 발생되었고, 투명 P. E. 멀칭재배에서는 많이 발생되었다. 3. 생육은 P. E. 멀칭재배가 짚멀칭이나 무멀칭보다 엽수가 많고 엽장이 커서 양호하였다. 4. 추대는 2∼5% 정도가 발생되었으며, P. E. 멀칭 재배에서 약간 많이 발생되는 경향이었다. 5. 수량은 P. E. 멀칭재배가 토양의 물리성이 좋아서 근수가 많고, 근장과 묘두직경이 커서 뿌리 생장이 양호하여 증수되었다.

• 대한수학회보
• /
• 제49권3호
• /
• pp.465-479
• /
• 2012

For $0<p{\leq}{\infty}$ and a convex body $K$ in $\mathbb{R}^n$, Lutwak, Yang and Zhang defined the concept of dual $L_p$-centroid body ${\Gamma}_{-p}K$ and $L_p$-John ellipsoid $E_pK$. In this paper, we prove the following two results: (i) For any origin-symmetric convex body $K$, there exist an ellipsoid $E$ and a parallelotope $P$ such that for $1{\leq}p{\leq}2$ and $0<q{\leq}{\infty}$, $E_qE{\supseteq}{\Gamma}_{-p}K{\supseteq}(nc_{n-2,p})^{-\frac{1}{p}}E_qP$ and $V(E)=V(K)=V(P)$; For $2{\leq}p{\leq}{\infty}$ and $0<q{\leq}{\infty}$, $2^{-1}{\omega_n}^{\frac{1}{n}}E_qE{\subseteq}{\Gamma}_{-p}K{\subseteq}{2\omega_n}^{-\frac{1}{n}}(nc_{n-2,p})^{-\frac{1}{p}}E_qP$ and $V(E)=V(K)=V(P)$. (ii) For any convex body $K$ whose John point is at the origin, there exists a simplex $T$ such that for $1{\leq}p{\leq}{\infty}$ and $0<q{\leq}{\infty}$, ${\alpha}n(nc_{n-2,p})^{-\frac{1}{p}}E_qT{\supseteq}{\Gamma}_{-p}K{\supseteq}(nc_{n-2,p})^{-\frac{1}{p}}E_qT$ and $V(K)=V(T)$.

• Journal of applied mathematics & informatics
• /
• 제36권3_4호
• /
• pp.237-244
• /
• 2018

Let ${\mathcal{H}}$ be an infinite dimensional separable Hilbert space with a fixed orthonormal base $\{e_1,e_2,{\cdots}\}$. Let L be the subspace lattice generated by the subspaces $\{[e_1],[e_1,e_2],[e_1,e_2,e_3],{\cdots}\}$ and let $Alg{\mathcal{L}}$ be the algebra of bounded operators which leave invariant all projections in ${\mathcal{L}}$. Let p and q be natural numbers (p < q). Let ${\mathcal{A}}$ be a linear manifold in $Alg{\mathcal{L}}$ such that $T_{(p,q)}=0$ for all T in ${\mathcal{A}}$. If ${\mathcal{A}}$ is a Lie ideal, then $T_{(p,p)}=T_{(p+1,p+1)}={\cdots}=T_{(q,q)}$ and $T_{(i,j)}=0$, $p{\eqslantless}i{\eqslantless}q$ and i < $j{\eqslantless}q$ for all T in ${\mathcal{A}}$.

• 호남수학학술지
• /
• 제42권3호
• /
• pp.569-576
• /
• 2020

An element x ∈ E is called a norming point of P ∈ P(ⁿE) if ║x║ = 1 and |P(x)| = ║P║. For P ∈ P(ⁿE), we define Norm(P) = {x ∈ E : x is a norming point of P}. Norm(P) is called the norming set of P. We classify Norm(P) for P ∈ 𝒫(²𝑙²_∞).

• 대한수학회논문집
• /
• 제9권3호
• /
• pp.669-670
• /
• 1994

Let $E \to M$ be a hermitian holomorphic vector bundle over a compact (complex) hermitian manifold M of complex dimension n, and let $$ d"_p(E) : 0 \to A^{p,0}(E) \to A^{p,1}(E) \to \cdots \to A^{p,n}(E) \to 0$$ be the Dolbeault complex. Then $A^{p,q}(E)$ become a prehibert space so that the formal adjoint $\delta"$ of $d"$ and the "Laplacian" $\Delta" = \delta" d" + d" \delta"$ are defined.quot; d" + d" \delta"$ are defined.;$ are defined.

• 한국유기농업학회지
• /
• 제21권3호
• /
• pp.413-422
• /
• 2013

친환경 마늘재배농가의 엽초유인 및 제초작업에 소요되는 노동력을 절감하고 비닐피복으로 인한 비상품성 마늘의 비율을 낮추기 위하여 왕겨 등 4종의 피복재료를 이용하여 본 시험을 수행하였다. 출현기는 투명P.E.필름 피복구에서 2월 18일로 가장 빨랐으며 무피복구에서 3월 23일로 가장 늦었고, 이중피복구는 투명P.E.필름 피복구보다 다소 늦다. 지상부 생육은 관행>이중피복구>무피복 순으로 양호한 생육을 보였지만 엽초장은 짚+투명P.E.피복구와 톱밥+P.E.피복구에서 투명P.E.필름 피복보다 양호하였다. 피복재료별 잡초발생량은 검정유공P.E.필름+투명P.E.피복구에서 가장 적었고, 이중 피복구에서 48%~56%의 방제가를 보였다. 이중피복 처리에 따른 육쪽비율을 보면 짚+투명P.E.피복구에서 가장 높았고, 이중 피복구가 투명P.E.필름 피복구보다 2배 이상 육쪽비율이 높은 경향을 보였다. 지하부 특성은 투명P.E.필름 피복구에서 구경, 구고, 구중이 가장 양호하였으나 이차생장율이 가장 높았으며, 왕겨+투명P.E.피복구에서 이차생장율이 가장 낮았다. 전체수량은 투명P.E.필름 피복구에서 961kg/10a로 가장 많았지만 상품수량은 왕겨 피복구에서 848kg/10a로 가장 많았다.

• 한국의류산업학회지
• /
• 제22권6호
• /
• pp.844-852
• /
• 2020

This study is to understand the preferences of pilots, flight engineers and crew who work in the same aircraft but are exposed to different working environments and perform different mission operations in order to develop an ergonomic flight jacket. Based on a preliminary investigation, a survey of 107 pilots and 36 flight engineers and crew was conducted. The results are as follows; Pilots can control the temperature inside the cockpit, so they are less exposed to the cold when working, while flight engineers and crew are exposed to the cold more because they have many external tasks. The reason for the problem of the current flight jacket was a difference in ranking between two groups, but the highest ranking was poor dimensional suitability due to the habit of wearing layers of clothing. As a result of preferred design, there were significant differences between groups in the item of overall style. Pilots preferred a bomber jacket style(P:68.2%, E&C:44.4%), on the other hand, flight engineers and crew preferred a field jacket style(P:26.2%, E&C:55.6%)(p<.01). They preferred a stand collar(P:71.0%, E&C:86.1%), a fastener slider for a front fastening(P:62.6%, E&C:61.1%), fastener tape cuffs(P:54.2%, E&C:47.2%), a jacket with a softshell(P:86.9%, E&C:83.3%), fleece as softshell material(P:88.8%, E&C:69.4%), and fastener sliders as a attaching method(P:69.2%, E&C:61.1%). A hem fastening will be selected differently according to the overall style of outshell. Additionally, they preferred more than 5ea pockets(P:51.4%, E&C:44.4%), fastener sliders as pocket's fastenings(P:48.6%, E&C:61.1%), armpit ventilations(P:62.9%, E&C:58.5%). The results of above will be considered to design an ergonomic flight jacket.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.