• 미생물학회지
• /
• 제53권4호
• /
• pp.286-291
• /
• 2017

진핵 세포에서 히스톤의 변형은 크로마틴 구조를 조절하는 데에 있어서 중요한 메커니즘이다. Set1 복합체에 의한 히스톤 H3의 네 번째 라이신 잔기(H3K4)에 발생하는 메틸화는 다양하게 잘 알려져 있는 히스톤 변형 중 하나이다. Set1 complex는 H2B의 유비퀴틴화에 의존적으로 발생하는 H3K4 메틸화에 중요하다고 알려진 Swd2를 포함하여 7개의 소단위 단백질을 가지고 있다. Swd2는 Set1의 RNA recognition motif (RRM) 도메인 근처에 결합하여 Set1의 활성을 조절하고, 또 RNA의 3' 말단 형성에 관여하는 CPF (Cleavage and Polyadenylation Factors) 복합체의 구성성분이라고 보고되었다. 최근 보고들에 따르면, 이런 Swd2의 이중적인 기능이 서로 독립적으로 작용하며, Swd2 결실돌연변이 균주가 살지 못하는 이유가 CPF 복합체의 구성성분으로써의 기능 때문이라고 알려져 있다. 본 연구에서 우리는 Swd2가 Set1의 RRM 도메인에 결합하여 Set1의 활성을 조절할 수 있을 뿐만 아니라, Set1의 안정성에도 영향을 줄 수 있음을 발견하였다. 또 우리는 Swd2가 결합할 수 없는 truncated-Set1을 가지고 있는 ${\Delta}swd2$ 돌연변이가 사멸하지 않고 정상적으로 자라는 것을 관찰하였다. 이런 결과들은 Saccharomyces cerevisiae에서 H3K4 메틸화와 RNA 3' 말단 형성과정에서의 Swd2의 이중적인 기능이 서로 독립적인 것이 아님을 제안하다.

• 대한방사성의약품학회지
• /
• 제8권2호
• /
• pp.53-61
• /
• 2022

This study aimed to increase the targeting ability against PSMA in cell therapy using metabolic glycoengineering and biorthogonal chemistry and to visualize cell trafficking using PET imaging. Cellular membranes of THP-1 cells were decorated with azide(-N₃) using Ac₄ManNAz by metabolic glycoengineering. Engineered THP-1 cells were conjugated with DBCO-bearing fluorophore (ADIBO-Cy5.5) for 1 h at different concentrations and analyzed by confocal fluorescence microscopy and flow cytometry. For PSAM ligand conjugation to THP-1 cells, Ac₄ManNAz treated THP-1 cells were incubated with DBCO-PSMA ligand (ADIBO-GUL) at a final concentration with 100 µM for 1 h. To evaluate the effect on cell recognition, PSMA ligand conjugated THP-1 cells(as effectors) were co-cultured with PSMA positive 22RV1 (as target cells) at 3 : 1 a effector-to-target cell (E/T) ratio. The interaction between THP-1 and 22RV1 was monitored by confocal fluorescence microscopy. For preparing the radiolabeled THP-1, the cells were treated at the activity of ~ 740 kBq of [⁸⁹Zr]Zr(oxinate)₄/5 × 10⁶ cells. Radiolabeled cells were analyzed for determination of cell-associated radioactivity by gamma counting and viability using MTS assay. In the cytotoxicity assay, THP-1 cells did not have any cytotoxicity even when the Ac₄ManNAz concentration was 100 µM. In confocal microscopy and flow cytometry, THP-1 cells were efficiently labeled ADIBO-Cy5.5 in a dose-dependent manner, and the dose of 100 µM was the optimal concentration for the following experiments. The clusters of PSMA ligand-conjugated THP-1 cells and 22RV1 cells were identified, indicating cell-cell recognition over the cell surface between two types of cells. Cell radiolabeling efficiency was 54.5 ± 17.8%. THP-1 labeled with 0.09 ± 0.03 Bq/cell showed no significant cytotoxicity compared to unlabeled THP-1 up to 7 days. We successfully demonstrated that Ac₄ManNAz treated cells were efficiently conjugated with ADIBO-GUL for preparing the PSMA-targeting cells, and [⁸⁹Zr]Zr(oxinate)₄ could be used to label cells without toxicity. It suggested that PSMA-ligand conjugated cell therapy could be improved cell targeting and be monitored by PET imaging.

• Bulletin of the Korean Chemical Society
• /
• 제25권2호
• /
• pp.216-220
• /
• 2004

${\beta}$-CD and CM- ${\beta}$-CD as chiral NMR shift agents were used to resolve the enantiomers of noradrenaline (NA). The stoichiometry of each complex formed between the CDs and the enantiomers of NA was found to be 1 : 1 through the continuous variation plots. The binding constants (K) of the complexes were determined from $^1H$ NMR titration curves. This result indicated that both ${\beta}$-CD and CM- ${\beta}$-CD formed the complexes with the S(+)-NA more preferentially than its R(-)-enantiomer. The K values for the complexes with ${\beta}$-CD ($K_{S(+)}$ = 537 $M^{-1}$ and $K_{R(-)}$ = 516 $M^{-1}$ was larger than those with CM- ${\beta}$-CD ($K_{S(+)}$ = 435 $M^{-1}$ and $K_{R(-)}$ = 313 $M^{-1}$), however, enantioselectivity (${\alpha}$) of S(+)- and R(-)-NA to CM- ${\beta}$-CD ( ${\alpha}$ = 1.38) was larger than that to ${\beta}$-CD ( ${\alpha}$ = 1.04), indicating that CM- ${\beta}$-CD was the better chiral NMR solvating agents for the recognition of the enantiomers of NA. Two dimensional rotating frame nuclear Overhauser enhancement spectroscopy (ROESY) experiments were also performed to explain the binding properties in terms of spatial fitting of the NA molecule into the macrocyclic cavities.

• KSBB Journal
• /
• 제11권2호
• /
• pp.193-200
• /
• 1996

DNA를 인식하여 절단하는 제한효소의 발견은 유전자를 연구, 조작할 수 있게 되어 분자생물학 연구에 큰 발전을 가져 왔다. 제한효소의 인식자리는 반 응용액의 산도, 유기용애의 소수성에 따라서 달라질 수 있다. 제한 효소 BamHI의 특이성 변화는 유기용 매의 소수성CLogP)과 산도에 직접적인 관계가 있다. 제한효소 BamHI의 인식자리의 특이성 변화는 산도 7.5에셔 LogP값이 -1.3~-1.35, 8.0에서 -1. 0 03~-2.5, 8.5에서 0.75~-2.5, 8.9에서 -0.32 ~­2 2.5 벙위에셔 각각 나타난다. 통일한 유기용매 혼합 물에서 산도가 알카리 일수록 낮은 유기용매 놓도에 서 특이성의 변화가 나타난다. DMSO용액에서 Bam H HI의 특이성 변화는 산도가 7.5일때 20% 농도에서 나타나지만 산도가 8.9일때는 4%에서 나타난다.

• Molecules and Cells
• /
• 제41권4호
• /
• pp.331-341
• /
• 2018

L-pipecolic acid is a non-protein amino acid commonly found in plants, animals, and microorganisms. It is a well-known precursor to numerous microbial secondary metabolites and pharmaceuticals, including anticancer agents, immunosuppressants, and several antibiotics. Lysine cyclodeaminase (LCD) catalyzes ${\beta}$-deamination of L-lysine into L-pipecolic acid using ${\beta}$-nicotinamide adenine dinucleotide as a cofactor. Expression of a human homolog of LCD, ${\mu}$-crystallin, is elevated in prostate cancer patients. To understand the structural features and catalytic mechanisms of LCD, we determined the crystal structures of Streptomyces pristinaespiralis LCD (SpLCD) in (i) a binary complex with $NAD^+$, (ii) a ternary complex with $NAD^+$ and L-pipecolic acid, (iii) a ternary complex with $NAD^+$ and L-proline, and (iv) a ternary complex with $NAD^+$ and L-2,4-diamino butyric acid. The overall structure of SpLCD was similar to that of ornithine cyclodeaminase from Pseudomonas putida. In addition, SpLCD recognized L-lysine, L-ornithine, and L-2,4-diamino butyric acid despite differences in the active site, including differences in hydrogen bonding by Asp236, which corresponds with Asp228 from Pseudomonas putida ornithine cyclodeaminase. The substrate binding pocket of SpLCD allowed substrates smaller than lysine to bind, thus enabling binding to ornithine and L-2,4-diamino butyric acid. Our structural and biochemical data facilitate a detailed understanding of substrate and product recognition, thus providing evidence for a reaction mechanism for SpLCD. The proposed mechanism is unusual in that $NAD^+$ is initially converted into NADH and then reverted back into $NAD^+$ at a late stage of the reaction.

• Journal of Microbiology
• /
• 제44권1호
• /
• pp.29-34
• /
• 2006

The purpose of this study was to develop molecular identification method for medical mushrooms and their preparations based on the nucleotide sequences of nuclear large subunit (LSD) rDNA. Four specimens were collected of each of the three representative medicinal mushrooms used in Korea: Ganoderma Incidum, Coriolus versicolor, and Fomes fomentarius. Fungal material used in these experiments included two different mycelial cultures and two different fruiting bodies from wild or cultivated mushrooms. The genomic DNA of mushrooms were extracted and 3 nuclear LSU rDNA fragments were amplified: set 1 for the 1.1-kb DNA fragment in the upstream region, set 2 for the 1.2-kb fragment in the middle, and set 3 for the 1.3-kb fragment downstream. The amplified gene products of nuclear large subunit rDNA from 3 different mushrooms were cloned into E. coli vector and subjected to nucleotide sequence determination. The sequence thus determined revealed that the gene sequences of the same medicinal mushroom species were more than $99.48\%$ homologous, and the consensus sequences of 3 different medicinal mushrooms were more than $97.80\%$ homologous. Restriction analysis revealed no useful restriction sites for 6-bp recognition enzymes for distinguishing the 3 sequences from one another, but some distinctive restriction patterns were recognized by the 4-bp recognition enzymes AccII and HhaI. This analysis was also confirmed by PCR-RFLP experiments on medicinal mushrooms.

• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• Journal of Plant Biotechnology
• /
• 제37권2호
• /
• pp.186-195
• /
• 2010

In most self-incompatible plant species, recognition of self-pollen is controlled by a single locus, termed the S-locus. The self-incompatibility (SI) system in Brassica is controlled sporophytically by multiple alleles at a single locus, designated as S, and involves cell-cell communication between male and female. Two highly polymorphic S locus genes, SLG (S locus glycoprotein) and SRK (S receptor kinase), have been identified, both of which are expressed predominantly in the stigmatic papillar cell. Gain-of-function experiments have demonstrated that SRK solely determines S haplotype-specificity of the stigma, while SLG enhances the recognition reaction of SI. The sequence analysis of the S locus genomic region of B. campestris (syn. rapa) has led to the identification of an anther-specific gene, designated as SP11/SCR, which is the male S determinant. Molecular analysis has demonstrated that the dominance relationships between S alleles in the stigma were determined by SRK itself, but not by the relative expression level. In contrast, the expression of SP11/SCR from the recessive S allele was specifically suppressed in the S heterozygote, suggesting that the dominance relationships in pollen were determined by the expression level of SP11/SCR. Furthermore, recent studies on recessive allele-specific DNA methylation of Brassica self-incompatibility alleles demonstrate that DNA methylation patterns in plants can vary temporally and spatially in each generation. In this review, we firstly present overview of self incompatibility system in Brassica and then describe dominance relationships in Brassica self- incompatibility regulated by allele-specific DNA methylation.

• Mass Spectrometry Letters
• /
• 제6권3호
• /
• pp.71-74
• /
• 2015

Low temperature plasma (LTP) ionization mass spectrometry (MS) is one of the widely used ambient analysis methods which allows soft-ionization and rapid analysis of samples in ambient condition with minimal or no sample preparation. One of the major advantages of LTP MS is selective analysis of low-molecular weight, volatile and low- to medium-polarity analytes in a sample. On the contrary, the selectivity for particular class of compound also implies its limitation in general analysis. One of the critical factors limiting LTP ionization efficiency is poor desorption of analytes with low volatility. In this study, a home-built LTP ionization source with Peltier heating sample stage was constructed to enhance desorption and ionization efficiencies of analytes in a sample and its performance was evaluated using standard mixture containing fatty acid ethyl esters (FAEEs). It was also used to reproduce the previous bacterial identification experiment using pattern-recognition for FAEEs. Our result indicates, however, that the bacterial differentiation from FAEE pattern recognition using LTP ionization MS still has many limitations.

• Journal of Ginseng Research
• /
• 제40권3호
• /
• pp.211-219
• /
• 2016

Background: Panax ginseng root is used in traditional oriental medicine for human health. Its main active components such as saponins and polysaccharides have been widely evaluated for treating diseases, but secondary active components such as oligosaccharides have been rarely studied. This study aimed to assess the impact of water-soluble ginseng oligosaccharides (WGOS), which were isolated from the warm-water extract of Panax ginseng root, on scopolamine-induced cognitive impairment in mice and its antineuroinflammatory mechanisms. Methods: We investigated the impact of WGOS on scopolamine-induced cognitive impairment in mice by using Morris water maze and novel object recognition task. We also analyzed the impact of WGOS on scopolamine-induced inflammatory response (e.g., the hyperexpression of proinflammatory cytokines IL-$1{\beta}$ and IL-6 and astrocyte activation) by quantitative real-time polymerase chain reaction and glial fibrillary acid protein (GFAP) immunohistochemical staining. Results: WGOS pretreatment protected against scopolamine-induced learning and memory deficits in the Morris water maze and in the novel object recognition task. Furthermore, WGOS pretreatment downregulated scopolamine-induced hyperexpression of proinflammatory cytokines interleukin (IL)-$1{\beta}$ and IL-6 mRNA and astrocyte activation in the hippocampus. These results indicate that WGOS can protect against scopolamine-induced alterations in learning and memory and inflammatory response. Conclusion: Our data suggest that WGOS may be beneficial as a medicine or functional food supplement to treat disorders with cognitive deficits and increased inflammation.