Plasmodiophora brassicae는 십자화과 작물에 뿌리혹병을 일으키는 주요 병원균이다. 본 연구에서는 뿌리혹병균의 신속 정확한 검출을 위해서 뿌리혹병균에 대한 새로운 종 특이적 프라이머를 개발하고자 하였다. 새롭게 개발된 프라이머들은 10종의 주요 토양병원균을 비롯하여 기주인 배추 DNA와는 반응하지 않고 P. brassicae와만 반응하는 특이성을 갖고 있었다. 그 가운데 Primer ITS1-1/1-2는 민감도 검정 결과, 10 spores/ml의 DNA까지 검출이 가능함으로써, first round PCR용임에도 불구하고 이전의 검출법 보다 감도가 높고 정확한 결과를 얻었다. Quantitative real-time PCR로 분석할 경우에는 더 적은 수의 포자까지 안정적으로 검출해 낼 수 있어 새로운 P. brassicae 종 특이적 프라이머로서의 유용성을 확인할 수 있었다.
rDNA내의 ITS region의 염기서열 분석 결과를 토대로 19종의 Phellinus 속균중 Phellinus linteus를 특이적으로 동정할 수 있는 primer를 제작하였다. 이 특이 primer는 ITS1과 ITS2내에 위치하며 이들 spacer region에 인접해 있는 universal Primer내에 위치해 있다. 총 4개의 Primer(universal primer인 ITS-1F와 ITS-4 그리고 특이 primer인 PL-F와 PL-R)가 한국에서 채집된 Phellinus 속균중 Phellinus linteus를 동정하는데 사용되었다. Phellinus linteus의 증폭된 DNA크기는 800bp(ITS-1F/ITS-4)와 720 bp(ITS-1F/PL-R과 PL-F/ITS-4)에 해당하는 2개의 band, 그리고 610 bp(PL-F/PL-R)인 것으로 나타났다. 한국에서 채집된 23종의 Phellinus속균중 13종이 Phellinus linteus인 것으로 확인되었다.
Kim, Dong-Hun;Chung, Hung-Chae;Ohga, Shoji;Lee, Sang-Sun
Mycobiology
/
제31권1호
/
pp.23-31
/
2003
With universal primer ITS1-F, the specific DHJ2 primer was developed to detect the Ectomycorrhizal(ECM) root tips in soil and to identify the species of ECM fungi, as based on DNA sequences of rDNA stored in GeneBank of NCBI. This primer was designed with the common sites of rDNA of Amanita and Boletus, and was also designed with several DNA programs provided by NCBI. The DNA fragments synthesized by PCR were calculated to be 1,000 to 1,200 bps of DNA located to 18s to 28s rDNA to contain two variable sites of ITS, indicating much diversities for specific species or ecotypes of ECM fungi. The primer DHJ2 reacted with the genomic DNA's extracted from the tissues of basidiocarp at the rate of 73 of 80 fungi collected produced single bands with a 1,100 bps length. The DNA fragment synthesized with the genomic DNA that extracted from eight ECM tips of Pinus densiflora was confirmed and analysized to the rDNAs of ECM in full sequences, and informed to be a ECM fungal species in the forest.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'- GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study.
Lee, Sun Keun;Lee, Jong Kyu;Lee, Seung Kyu;Kim, Kyung Hee;Lee, Sang Yong
한국산림과학회지
/
제96권5호
/
pp.585-590
/
2007
Rhizina undulata is the fungus, which causes Rhizina root rot on coniferous trees. Nested-PCR using ITS-specific primer was applied to detect R. undulata from the soils of Japanese black pine (Pinus thunbergil) forests infested with the disease in Seocheon, Chungnam Province, South Korea. Soil samples were collected from four different sites, both dead trees and fruit bodies of R. undulata were present, dead trees only present, fruit bodies only present, and both were absent. Nested-PCR products specific to R. undulata ITS-region were amplified. Positive reactions were found in some samples from the sites, where dead trees and fruit bodies of R. undulata were absent as well as where both of those were present. R. undulata was mainly detected in the soil samples from the depth of 5~20 cm under the soil surface. These results show that the nested-PCR could be used to diagnose the presence or potential infestation of R. undulata in the soils of pine forests.
A technique based on the polymerase chain reaction (PCR) for the specific detection of genus Phytophthora and Phytophthora cryptogea-P. drechsleri complex group was developed using nucleotide sequence information of ribosomal DNA (rDNA) regions. The internal transcribed spacers (ITS) including 5.8S were sequenced for P. cryptogea-P. drechsleri complex group and its related species. Two pairs of oligonucleotide primers were designed. Primer pair ITS1/Phy amplified ca. 240 bp fragment in 12 out of 13 specie of Phytophthora, but not in Pythium spp., Fusarium spp.and Rhizoctonia solani. Primer pair rPhy/Pcd amplified 549 bp fragment only in P. cryptogea-P. drechsleri complex group, but not in other Phytophthora spp.and other genera. Specific PCR amplification using the primers was successful in detecting Phytophthora and P. cryptogea-P. drechsleri complex group in diseased plants.
We developed an mPCR assay for the simultaneous detection, in one tube, of Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus and Listeria monocytogenes using species-specific primers. The mPCR employed the E. coli O157:H7 specific primer Stx2A, Salmonella spp. specific primer Its, S. aureus specific primer Cap8A-B and L. monocytogenes specific primer Hly. Amplification with these primers produced products of 553, 312, 405 and 210 bp, respectively. All PCR products were easily detected by agarose gel electrophoresis, and the sequences of the specific amplicons assessed. Potential pathogenic bacteria, in laboratory-prepared and four commercially available kimchi products, were using this mPCR assay, and the amplicons cloned and sequenced. The results correlated exactly with sequences derived for amplicons obtained during preliminry tests with known organisms. The sensitivity of the assay was determined for the purified pathogen DNAs from four strains. The mPCR detected pathogen DNA at concentrations ranging from approximately 0.45 to $0.05\;pM/{\mu}l$. Thus, this mPCR assay may allow for the rapid, reliable and cost-effective identification of four potentially pathogens present in the mixed bacterial communities of commercially available kimchi.
Proceedings of the National Institute of Ecology of the Republic of Korea
/
제4권4호
/
pp.154-158
/
2023
The Asiatic black bear, Ursus thibetanus, is among the most threatened or endangered species in Asia. For its conservation and management, sex identification of U. thibetanus using non-invasive samples (e.g., hair and/or feces) is potentially valuable. In this study, a non-invasive molecular method for sex identification of U. thibetanus samples collected from various countries was first utilized, and it was based on polymerase chain reaction (PCR) amplification of the amelogenin gene via PCRs. Thirty-three bear DNA samples, extracted not only from blood (n=9) but also from hair (n=18) and feces (n=6), were used. We performed sex-specific PCR amplifications of the amelogenin gene using a primer set, SE47 and SE48. The primer set could successfully amplify a single X-specific band for females and both X- and Y-specific bands for males from all blood (100%) and hair (100%) samples. In addition, the primer set could distinguish the sex of bears in four out of a total of six fecal samples (approximately 67%). This study's findings suggest that this molecular method can be applied to sex identification of Asiatic black bears from various Asian regions using non-invasive samples, such as hair and feces.
Cylindrocarpon destructans는 인삼 및 수목에 뿌리썩음병을 일으키는 토양 전염병 식물병원균이다. 신속 정확한 검출 가능성을 알아보기 위하여 종 특이적인 primer와 nested PCR 기법을 활용하여 인삼 유묘로부터 뿌리썩음 병균 C. destructans로 2차 PCR증폭을 실시한 결과 병원성이 확인된 C.destructans에서만 400bp의 종특이적 증폭산물을 얻을 수 있었다. 종 특이성 primer 와 nested PCR 기법을 이용한 인삼뿌리썩음병균 DNA에 대한 반응 민감도는 최저 약 1fg으로 나타나 단 몇 개의 포자만 존재해도 검출이 가능하였다. 또한, nested PCR 기법은 실제 이병토양에 심었을 경우에도 C.destructans 에 감염된 인삼 유묘로부터만 정확하게 병원균을 검출해 내었다. 종특이적 primer 와 nested PCR 기법을 이용한 본 연구 결과는 실제 재배농가에서 인삼 경작시 뿌리썩음병 진단에 매우 유용하게 활용될 수 있을 것으로 판단된다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.