• Mycobiology
• /
• 제48권4호
• /
• pp.313-320
• /
• 2020

In Pleurotus sp., green mold, which is considered a major epidemic, is caused by several Trichoderma species. To develop a rapid molecular marker specific for Trichoderma spp. that potentially cause green mold, eleven Trichoderma species were collected from mushroom farms and the Korean Agricultural Culture Collection (KACC). A dominant fungal isolate from a green mold-infected substrate was identified as Trichoderma pleuroticola based on the sequences of its internal transcribed spacer (ITS) and translation elongation factor 1-α (tef1) genes. In artificial inoculation tests, all Trichoderma spp., including T. atroviride, T. cf. virens, T. citrinoviride, T. harzianum, T. koningii, T. longibrachiatum, T. pleurotum, and T. pleuroticola, showed pathogenicity to some extent, and the observed symptoms were soaked mycelia with a red-brown pigment and retarded mycelium regeneration. A molecular marker was developed for the rapid detection of wide range of Trichoderma spp. based on the DNA sequence alignment of the ITS1 and ITS2 regions of Trichoderma spp. The developed primer set detected only Trichoderma spp., and no cross reactivity with edible mushrooms was observed. The detection limits for the PCR assay of T. harzianum (KACC40558), T. pleurotum (KACC44537), and T. pleuroticola (CAF-TP3) were found to be 500, 50, and 5 fg, respectively, and the detection limit for the pathogen-to-host ratio was approximately 1:10,000 (wt/wt).

• 대한본초학회지
• /
• 제37권4호
• /
• pp.9-16
• /
• 2022

Objectives : In the Korean Pharmacopoeia 12th edition (KP 12) and the Korean Herbal Pharmacopoeia (KHP), two authentic herbal medicines are described, namely Bang-gi (Cheong-pung-deung) and Mok-bang-gi, respectively. In China, Bun-bang-gi is also used as herbal medicine. This study was conducted to develop a molecular authentication tool for distinguishing the three herbal medicine used as Bang-gi, which are Sinomeni Caulis et Rhizoma (Rhizome of Sinomenium acutum), Stephaniae Tetrandrae Radix (Root of Stephania terandra), and Cocculi Radix (Root of Cocculus trilobus). Methods : Twelve samples of three species (four samples of S. acutum, five samples of S. tetrandra, and three samples of C. trilobus) were collected from different habitats. The sequences of internal transcribed spacer (ITS) regions were obtained and comparatively analyzed to design the species-specific sequence characterized amplified region (SCAR) primers. The specificity of each pair of SCAR primers that amplified species-specific amplicon was evaluated for establishing the singleplex and multiplex PCR assay tools. Results : The singleplex SCAR markers show discriminability in C. acutum, S. tetrandra, and C. trilobus. These SCAR markers were also efficiently authenticated three species in the multiplex SCAR amplification using single PCR reaction. Furthermore, these PCR assay methods were applicable to authenticate dried herbal medicines distributed in the markets. Conclusions : The SCAR markers and PCR assay tools help discriminate the three herbal medicines used as Bang-gi at the species levels and provide a reliable genetic method to prevent the inauthentic distribution of these herbal medicines.

• 사상체질의학회지
• /
• 제18권1호
• /
• pp.147-154
• /
• 2006

1. Objectives This study was aimed to evaluate marker substances in Gamijowi-tang by high performance liquid chromatography(HPLC) 2. Methods The seperation was performed an AquasilC18(4.6X250mm)column by gradient elution with 0.1N H3PO4 in H2O - acetonitrile(0min 100:10,20min60:40, 40min 80:20, 60min 100:0) as the mobile phase at a flow-rate of 1.0 ml/min with detection at 190-800nm 3. Results Ephedrine and schizandrin were established as marker substances in Gamijowi-tang and its qualitative analysis was carried out. Analyzed was similarity of marker substances between in standard article and in Gamijowi-tang. The result of the analysis was that ephedrine and schizadrin showed 0.9999 of similarity, which meant they were really ephedrine and schizadrin. In addition, ephedrin content was 12.16mg, pseudoephedrine conrenr was 5.09mg, and schizandrin content was 26.6mg in 76g of Gamijowi-tang. 4. Conclusions Qualitative and quantitative analyses of ephedrine and schizandrin in Gamijowi-tang were conducted, and it was identified thar they could be used as marker substances in standardizing quality of Gamijowi-rang.

• 대한본초학회지
• /
• 제29권6호
• /
• pp.35-43
• /
• 2014

Objectives : Official Arisaematis Rhizoma is described only three species, Arisaema amurnse, Arisaema erubescens, and Arisaema heterophyllum, in national Pharmacopoeia. However, other Arisaema species, Arisaema ringens, Arisaema takesimense and Arisaema serratum, also have been distributed as an inauthentic Arisaematis Rhizoma in the herbal market. To develop a reliable molecular authentication method for Arisaematis Rhizoma in species level, we analyzed DNA barcode regions using six Arisaema species. Methods : Thirty-eight samples of six Arisaema plants species (A. amurense, A. amurense f. serratum, A. heterophyllum, A. takesimense, and A. serratum) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL gene) were analyzed after PCR amplification. The species-specific sequences and phylogenetic relations were estimated using entire sequences of three DNA barcodes based on the analysis of ClastalW and UPGMA, respectively. Results : The comparative analysis of DNA barcode sequences were revealed inter-species specific nucleotides to distinguish the medicinal plant of Arisaema Rhizoma in species levels excluding between A. amurense and its subspecies (A. amurense f. serratum) and A. takesimense and A. serratum, respectively. However, we obtained sequence differences enough to discriminate authentic and inauthentic Arisaematis Rhizoma. Therefore, we suggest that these SNP type molecular genetic markers were an reliable method avaliable to identify official herbal medicines. Conclusions : These marker nucleotides could be useful to identify the official herbal medicines by providing definitive information that can identify original medicinal plant and distinguish from inauthentic adulterants and substitutes.

• 사상체질의학회지
• /
• 제21권1호
• /
• pp.227-236
• /
• 2009

1. Objectives As a basic trial for identification of Sasang constitutional gene marker, we genotyped and analysed statistical relationships of STR(short tandem repeat) alleles and its distribution in each constitution. 2. Methods After obtaining basic constitutional data with questionnaire (QSCC II), decision of constitution was made by 3 different constitution specialists' diagnosis, and only the samples of specialists' agreement of each constitution by discussion were taken into this research. Using multiplex PCR kit, total 146 constitutional samples were amplified in 16 autosomal STR marker, genotyped, and analysed statistically. Among 16 markers, 15 were analysed in this study excluding the amelogenin marker is used for in gender identification. 3. Results and Conclusions It is difficult to determine the relationship between constitution and STR marker as the sample size is small, however, Penta D and vWA were shown to be related statistically with constitution. It has been know that STRs has no genetic informations, however there are some recent research results showing STRs as a regulatory element, relationship between microsatellite instability and repeat number and size, and post-transcriptional sigualing. STRs which is not known about its function currently, are proposed to have function and/or regulatory activities anyhow with Sasang constitution. It is believed that the results of this study can halp determine and deatify the markers related to Sasang Constitutional Medicien.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Bulletin of the Korean Chemical Society
• /
• 제34권8호
• /
• pp.2330-2334
• /
• 2013

A highly selective molecularly imprinted polymer (MIP) for sarcosine, a cancer marker, was prepared and its use as solid-phase extraction (SPE) sorbent material was demonstrated. The MIP was prepared by a very simple procedure using methacrylic acid as functional monomer and a mixture acetonitrile/water (4/1, v/v) as porogen, overcoming in this way the problems usually related to the imprinting of biological polar compounds. The MIP was tested in batch experiments in order to evaluate its binding properties and then used as SPE sorbent for the selective clean-up and pre-concentration of sarcosine. The extraction protocol was successfully applied to the direct extraction of sarcosine from spiked human urine indicating that the MIP allowed sarcosine to be pre-concentrated while simultaneously interfering compounds were removed from the matrix.

• 한국식품위생안전성학회지
• /
• 제37권1호
• /
• pp.29-37
• /
• 2022

본 연구에서는 발효노니를 건강기능식품 소재로 활용 시 기초자료로 제공하고자 발효노니 추출물 및 지표성분의 면역활성 증진 효과를 평가하였다. RAW 264.7 대식세포에서 발효노니 추출물 및 지표성분 6종을 처리하여 XTT 세포독성평가, Nitric Oxide 생성 측정, Cyokine 생성 측정, immune marker genes 발현분석 수행하였다. 뿐만 아니라 양성대조군으로 LPS와 기능성 원료로 사용되고 있는 발효홍삼 추출물을 사용하였다. 그 결과 모든 처리 농도 및 처리군에서 세포독성이 관찰되지 않았으며, 지표성분 6종 중 SCP 및 ASE에서 NO 생성이 증가됨을 확인하였다. 뿐만 아니라 ASE 처리군에서는 IL-6 및 IL-1β의 생성이 증가되었으며, iNOS 및 TNF-α의 immune marker genes 발현이 증가됨을 확인하였다. 발효노니 추출물 효능 평가에서는 발효시 NO 생성 및 IL-6, IL-1β의 생성, COX2의 발현이 증가되는 것으로 나타났다. 이러한 연구 결과는 발효노니 추출물 및 지표성분의 선천면역 활성증가를 타나내며 노니 및 발효노니 표준화 연구에서 지표성분으로 사용 가능성을 제시한다. 따라서 발효노니는 면역증진 활성을 갖는 제품 개발에 있어서 유용한 기능성 식품소재로써 사용될 수 있으며, 우수한 효능을 나타내는 지표성분은 유용성분으로 이용이 가능할 것으로 사료된다.

• 대한본초학회지
• /
• 제25권4호
• /
• pp.47-54
• /
• 2010

Objectives : The original plant species of Schisandrae Fructus (O-mi-ja) is prescribed as Schisandra chinensis $B_{AILL.}$, in Korea, but S. chinensis $B_{AILL.}$ and S. sphenanthera $R_{EHD.}$ et $W_{ILS.}$ in China. Moreover, fruit of several other species in genus Schisandra also have been used as the same herbal medicines. To develop a reliable method for correct identification of Schisandrae Fructus and to evaluate the phylogenetic relationship of S. chinensis and its related species, we analyzed internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA (nrDNA). Methods : Twenty-four plant samples of three Schisandra species and one Kadsura species, S. chinensis $B_{AILL.}$, S. spenanthera $R_{EHD.}$ et $W_{ILS.}$, S. nigra $M_{ax.}$ and Kadsura japonica $D_{UNAL}$ were collected from each different native habitate and farm in Korea and China. The nrDNA-ITS region of each samples were amplified using ITS1 and ITS4 primer and nucleotide sequences were determined after sub-cloning into the pGEM-Teasy vector. Authentic marker nucleotides were estimated by the analysis of ClastalW based on the entire nrDNA-ITS sequence. Results : In comparative analysis of the nrDNA-ITS sequences, we found specific nucleotide sequences including indels (insertions and deletions) and substitutions to distinguish C. chinensis, S. spenanthera, S. nigra, and K. japonica. These sequence differences at corresponding positions are avaliable nucleotide markers to determine the botanical origin of O-mi-ja. Moreover, we evaluated the phylogenetic relationship of four plant species by the analysis of nrDNA-ITS sequences. Conclusions : These marker nucleotides would be useful to identify the official herbal medicines by the providing of definitive information that can identify each plant species and distinguish it from unauthentic adulterants for O-mi-ja.

• Asian Pacific Journal of Cancer Prevention
• /
• 제14권8호
• /
• pp.4539-4543
• /
• 2013

Background: Transitional cell carcinoma (TCC) is the most predominant type of urinary bladder tumor. As cyclooxygenase (COX)-2 is recently introduced as an attractive target molecule in bladder TCC, we evaluated the immunohistochemical expression of this marker and its association with several clinicopathological characteristics. Materials and Methods: This cross-sectional study was performed in the Pathology department of Sina Hospital in Tehran, Iran during 2006-2011. Ninety-two paraffin embedded blocks were selected from patients with urinary bladder TCC who underwent cystectomy or transurethral resection (TUR). Then, we assessed COX-2 expression by immunohistochemical staining using antibody against COX-2. Staining in more than 5% of tumor cells was considered as positive expression. Results: COX-2 was expressed in 50 % of our patients. This marker was markedly expressed in high grade bladder TCC (62.1%) versus other grades and there was statistically a significant difference in COX-2 expression between various grades (p=0.008). In addition, patients' age, lymphatic and perineurial invasion were associated with the expression of COX-2 (p=0.001, 0.015 and 0.039, respectively). However, other parameters such as stage, tumor size, venous invasion and lymph node metastasis did not show any significant relationship with this marker (all, p>0.05). Conclusions: COX-2 was expressed in urinary bladder TCC especially in high grade forms, advocating its probable role in the differentiation of this tumor. Accordingly, COX-2 could be a valuable biological target molecule in the evaluation and treatment of patients with bladder TCC.