Lee, Song Hee;Jung, Hwa Jin;Hong, Seung-Beom;Choi, Jong In;Ryu, Jae-San
Mycobiology
/
제48권4호
/
pp.313-320
/
2020
In Pleurotus sp., green mold, which is considered a major epidemic, is caused by several Trichoderma species. To develop a rapid molecular marker specific for Trichoderma spp. that potentially cause green mold, eleven Trichoderma species were collected from mushroom farms and the Korean Agricultural Culture Collection (KACC). A dominant fungal isolate from a green mold-infected substrate was identified as Trichoderma pleuroticola based on the sequences of its internal transcribed spacer (ITS) and translation elongation factor 1-α (tef1) genes. In artificial inoculation tests, all Trichoderma spp., including T. atroviride, T. cf. virens, T. citrinoviride, T. harzianum, T. koningii, T. longibrachiatum, T. pleurotum, and T. pleuroticola, showed pathogenicity to some extent, and the observed symptoms were soaked mycelia with a red-brown pigment and retarded mycelium regeneration. A molecular marker was developed for the rapid detection of wide range of Trichoderma spp. based on the DNA sequence alignment of the ITS1 and ITS2 regions of Trichoderma spp. The developed primer set detected only Trichoderma spp., and no cross reactivity with edible mushrooms was observed. The detection limits for the PCR assay of T. harzianum (KACC40558), T. pleurotum (KACC44537), and T. pleuroticola (CAF-TP3) were found to be 500, 50, and 5 fg, respectively, and the detection limit for the pathogen-to-host ratio was approximately 1:10,000 (wt/wt).
Objectives : In the Korean Pharmacopoeia 12th edition (KP 12) and the Korean Herbal Pharmacopoeia (KHP), two authentic herbal medicines are described, namely Bang-gi (Cheong-pung-deung) and Mok-bang-gi, respectively. In China, Bun-bang-gi is also used as herbal medicine. This study was conducted to develop a molecular authentication tool for distinguishing the three herbal medicine used as Bang-gi, which are Sinomeni Caulis et Rhizoma (Rhizome of Sinomenium acutum), Stephaniae Tetrandrae Radix (Root of Stephania terandra), and Cocculi Radix (Root of Cocculus trilobus). Methods : Twelve samples of three species (four samples of S. acutum, five samples of S. tetrandra, and three samples of C. trilobus) were collected from different habitats. The sequences of internal transcribed spacer (ITS) regions were obtained and comparatively analyzed to design the species-specific sequence characterized amplified region (SCAR) primers. The specificity of each pair of SCAR primers that amplified species-specific amplicon was evaluated for establishing the singleplex and multiplex PCR assay tools. Results : The singleplex SCAR markers show discriminability in C. acutum, S. tetrandra, and C. trilobus. These SCAR markers were also efficiently authenticated three species in the multiplex SCAR amplification using single PCR reaction. Furthermore, these PCR assay methods were applicable to authenticate dried herbal medicines distributed in the markets. Conclusions : The SCAR markers and PCR assay tools help discriminate the three herbal medicines used as Bang-gi at the species levels and provide a reliable genetic method to prevent the inauthentic distribution of these herbal medicines.
1. Objectives This study was aimed to evaluate marker substances in Gamijowi-tang by high performance liquid chromatography(HPLC) 2. Methods The seperation was performed an AquasilC18(4.6X250mm)column by gradient elution with 0.1N H3PO4 in H2O - acetonitrile(0min 100:10,20min60:40, 40min 80:20, 60min 100:0) as the mobile phase at a flow-rate of 1.0 ml/min with detection at 190-800nm 3. Results Ephedrine and schizandrin were established as marker substances in Gamijowi-tang and its qualitative analysis was carried out. Analyzed was similarity of marker substances between in standard article and in Gamijowi-tang. The result of the analysis was that ephedrine and schizadrin showed 0.9999 of similarity, which meant they were really ephedrine and schizadrin. In addition, ephedrin content was 12.16mg, pseudoephedrine conrenr was 5.09mg, and schizandrin content was 26.6mg in 76g of Gamijowi-tang. 4. Conclusions Qualitative and quantitative analyses of ephedrine and schizandrin in Gamijowi-tang were conducted, and it was identified thar they could be used as marker substances in standardizing quality of Gamijowi-rang.
Objectives : Official Arisaematis Rhizoma is described only three species, Arisaema amurnse, Arisaema erubescens, and Arisaema heterophyllum, in national Pharmacopoeia. However, other Arisaema species, Arisaema ringens, Arisaema takesimense and Arisaema serratum, also have been distributed as an inauthentic Arisaematis Rhizoma in the herbal market. To develop a reliable molecular authentication method for Arisaematis Rhizoma in species level, we analyzed DNA barcode regions using six Arisaema species. Methods : Thirty-eight samples of six Arisaema plants species (A. amurense, A. amurense f. serratum, A. heterophyllum, A. takesimense, and A. serratum) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL gene) were analyzed after PCR amplification. The species-specific sequences and phylogenetic relations were estimated using entire sequences of three DNA barcodes based on the analysis of ClastalW and UPGMA, respectively. Results : The comparative analysis of DNA barcode sequences were revealed inter-species specific nucleotides to distinguish the medicinal plant of Arisaema Rhizoma in species levels excluding between A. amurense and its subspecies (A. amurense f. serratum) and A. takesimense and A. serratum, respectively. However, we obtained sequence differences enough to discriminate authentic and inauthentic Arisaematis Rhizoma. Therefore, we suggest that these SNP type molecular genetic markers were an reliable method avaliable to identify official herbal medicines. Conclusions : These marker nucleotides could be useful to identify the official herbal medicines by providing definitive information that can identify original medicinal plant and distinguish from inauthentic adulterants and substitutes.
1. Objectives As a basic trial for identification of Sasang constitutional gene marker, we genotyped and analysed statistical relationships of STR(short tandem repeat) alleles and its distribution in each constitution. 2. Methods After obtaining basic constitutional data with questionnaire (QSCC II), decision of constitution was made by 3 different constitution specialists' diagnosis, and only the samples of specialists' agreement of each constitution by discussion were taken into this research. Using multiplex PCR kit, total 146 constitutional samples were amplified in 16 autosomal STR marker, genotyped, and analysed statistically. Among 16 markers, 15 were analysed in this study excluding the amelogenin marker is used for in gender identification. 3. Results and Conclusions It is difficult to determine the relationship between constitution and STR marker as the sample size is small, however, Penta D and vWA were shown to be related statistically with constitution. It has been know that STRs has no genetic informations, however there are some recent research results showing STRs as a regulatory element, relationship between microsatellite instability and repeat number and size, and post-transcriptional sigualing. STRs which is not known about its function currently, are proposed to have function and/or regulatory activities anyhow with Sasang constitution. It is believed that the results of this study can halp determine and deatify the markers related to Sasang Constitutional Medicien.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
A highly selective molecularly imprinted polymer (MIP) for sarcosine, a cancer marker, was prepared and its use as solid-phase extraction (SPE) sorbent material was demonstrated. The MIP was prepared by a very simple procedure using methacrylic acid as functional monomer and a mixture acetonitrile/water (4/1, v/v) as porogen, overcoming in this way the problems usually related to the imprinting of biological polar compounds. The MIP was tested in batch experiments in order to evaluate its binding properties and then used as SPE sorbent for the selective clean-up and pre-concentration of sarcosine. The extraction protocol was successfully applied to the direct extraction of sarcosine from spiked human urine indicating that the MIP allowed sarcosine to be pre-concentrated while simultaneously interfering compounds were removed from the matrix.
본 연구에서는 발효노니를 건강기능식품 소재로 활용 시 기초자료로 제공하고자 발효노니 추출물 및 지표성분의 면역활성 증진 효과를 평가하였다. RAW 264.7 대식세포에서 발효노니 추출물 및 지표성분 6종을 처리하여 XTT 세포독성평가, Nitric Oxide 생성 측정, Cyokine 생성 측정, immune marker genes 발현분석 수행하였다. 뿐만 아니라 양성대조군으로 LPS와 기능성 원료로 사용되고 있는 발효홍삼 추출물을 사용하였다. 그 결과 모든 처리 농도 및 처리군에서 세포독성이 관찰되지 않았으며, 지표성분 6종 중 SCP 및 ASE에서 NO 생성이 증가됨을 확인하였다. 뿐만 아니라 ASE 처리군에서는 IL-6 및 IL-1β의 생성이 증가되었으며, iNOS 및 TNF-α의 immune marker genes 발현이 증가됨을 확인하였다. 발효노니 추출물 효능 평가에서는 발효시 NO 생성 및 IL-6, IL-1β의 생성, COX2의 발현이 증가되는 것으로 나타났다. 이러한 연구 결과는 발효노니 추출물 및 지표성분의 선천면역 활성증가를 타나내며 노니 및 발효노니 표준화 연구에서 지표성분으로 사용 가능성을 제시한다. 따라서 발효노니는 면역증진 활성을 갖는 제품 개발에 있어서 유용한 기능성 식품소재로써 사용될 수 있으며, 우수한 효능을 나타내는 지표성분은 유용성분으로 이용이 가능할 것으로 사료된다.
Objectives : The original plant species of Schisandrae Fructus (O-mi-ja) is prescribed as Schisandra chinensis $B_{AILL.}$, in Korea, but S. chinensis $B_{AILL.}$ and S. sphenanthera $R_{EHD.}$ et $W_{ILS.}$ in China. Moreover, fruit of several other species in genus Schisandra also have been used as the same herbal medicines. To develop a reliable method for correct identification of Schisandrae Fructus and to evaluate the phylogenetic relationship of S. chinensis and its related species, we analyzed internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA (nrDNA). Methods : Twenty-four plant samples of three Schisandra species and one Kadsura species, S. chinensis $B_{AILL.}$, S. spenanthera $R_{EHD.}$ et $W_{ILS.}$, S. nigra $M_{ax.}$ and Kadsura japonica $D_{UNAL}$ were collected from each different native habitate and farm in Korea and China. The nrDNA-ITS region of each samples were amplified using ITS1 and ITS4 primer and nucleotide sequences were determined after sub-cloning into the pGEM-Teasy vector. Authentic marker nucleotides were estimated by the analysis of ClastalW based on the entire nrDNA-ITS sequence. Results : In comparative analysis of the nrDNA-ITS sequences, we found specific nucleotide sequences including indels (insertions and deletions) and substitutions to distinguish C. chinensis, S. spenanthera, S. nigra, and K. japonica. These sequence differences at corresponding positions are avaliable nucleotide markers to determine the botanical origin of O-mi-ja. Moreover, we evaluated the phylogenetic relationship of four plant species by the analysis of nrDNA-ITS sequences. Conclusions : These marker nucleotides would be useful to identify the official herbal medicines by the providing of definitive information that can identify each plant species and distinguish it from unauthentic adulterants for O-mi-ja.
Background: Transitional cell carcinoma (TCC) is the most predominant type of urinary bladder tumor. As cyclooxygenase (COX)-2 is recently introduced as an attractive target molecule in bladder TCC, we evaluated the immunohistochemical expression of this marker and its association with several clinicopathological characteristics. Materials and Methods: This cross-sectional study was performed in the Pathology department of Sina Hospital in Tehran, Iran during 2006-2011. Ninety-two paraffin embedded blocks were selected from patients with urinary bladder TCC who underwent cystectomy or transurethral resection (TUR). Then, we assessed COX-2 expression by immunohistochemical staining using antibody against COX-2. Staining in more than 5% of tumor cells was considered as positive expression. Results: COX-2 was expressed in 50 % of our patients. This marker was markedly expressed in high grade bladder TCC (62.1%) versus other grades and there was statistically a significant difference in COX-2 expression between various grades (p=0.008). In addition, patients' age, lymphatic and perineurial invasion were associated with the expression of COX-2 (p=0.001, 0.015 and 0.039, respectively). However, other parameters such as stage, tumor size, venous invasion and lymph node metastasis did not show any significant relationship with this marker (all, p>0.05). Conclusions: COX-2 was expressed in urinary bladder TCC especially in high grade forms, advocating its probable role in the differentiation of this tumor. Accordingly, COX-2 could be a valuable biological target molecule in the evaluation and treatment of patients with bladder TCC.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.