• 대한화학회지
• /
• 제48권4호
• /
• pp.447-450
• /
• 2004

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Asian-Australasian Journal of Animal Sciences
• /
• 제16권1호
• /
• pp.15-22
• /
• 2003

Experiments were conducted to evaluate the effect of blastomere diameters and cell cycle stages on the subsequent development of nuclear transplant rabbit embryos (NT-embryos) using nuclei derived from the 16- or 32-cell stage embryos. All blastomeres and NT-embryos were cultured individually in modified Ham's F-10 medium supplemented with 10% rabbit serum (RS) at $38^{\circ}C$ and 5% $CO_2$ in air. The diameter of blastomeres from 16-cell stage embryos was found twice of those from 32-cell stage (51 vs 27 ${\mu}m$). Significant differences were observed in cleavage rates ($\geq$3 divisions) in the isolated single blastomeres (54 vs 48 for 16-cell; 28 vs 14 for 32-cell, p<0.05), but the fusion rates of oocytes with transferred nuclei were similar between small and large single blastomeres derived from either 16-cell or 32-cell stage embryos. When 16-cell stage blastomeres were used as nuclear donors, cleavage rates ($\geq$3 divisions) of the NT-embryos were greater in the small nuclear donors than in the large donors (73 vs 55%, p<0.05). On the contrary, significantly higher cleavage (43 vs 6%, p<0.05) and developmental rates (14 vs 0%, p<0.05) were observed in the large blastomere nuclear donor group of the 32-cell stage embryos. When the cell cycle stages were controlled by a microtubule polymerization inhibitor (Demicolcine, DEM) or the combined treatment of DEM and Aphidicolin (APH), a DNA polymerase inhibitor, fusion rates were 88-96% for the 16-cell donor group (without DEM treatment), which were greater than the 32-cell donor group (54-58%). Cleavage rates were also greater in the transplants derived from G1 nuclear donor group (93-95%) than those from the DEM and APH combined treatment (73%) for the 16-cell donor group (p<0.05). No significant difference was detected in the morula/blastocyst rates in either donor cell stage (p>0.05). In conclusion, it appeared that no difference in the developmental competence between large and small isolated blastomeres was observed. When smaller 16-cell stage blastomeres were used as nuclear donor, the cleavage rate or development of NT-embryos was improved and was compromised when 32-cell stage blastomeres were used. Therefore, control nuclear stage of the donor cell at $G_1$ phase in preactivated nuclear recipients seemed to be beneficial for the cleavage rate of the reconstructed embryo in the 16-cell transplant, but not for subsequent morula or blastocyst development.

• BMB Reports
• /
• 제38권2호
• /
• pp.191-197
• /
• 2005

Although the human genome has been nearly completely sequenced, the functions and the roles of the vast majority of the genes, and the influences of single nucleotide polymorphisms (SNPs) in these genes are not entirely known. A modified mutation detection method was developed for large-scale cloning of the possible SNPs between tumor and normal cells for facilitating the identification of genetic factors that associated with cancer formation and progression. The method involves hybridization of restriction enzyme-cut chromosomal DNA, cleavage and modification of the sites of differences by enzymes, and differential cloning of sequence variations with a designed vector. Experimental validations of the presence and location of sequence variations in the isolated clones by PCR and DNA sequencing support the capability of this method in identifying sequence differences between tumor cells and normal cells.

• Journal of Acupuncture Research
• /
• 제22권5호
• /
• pp.91-97
• /
• 2005

This study was performed to investigate the effects of anti-cancer response of Lonicerae Flos Herbal-acupuncture. Experimental studies were evaluated through the anti-cancer response activities such as, cell viability, DNA fragmentation, and Apoptosis The results obtained were summarized as follows : 1. Lonicerae Flos Herbal-acupuncture($>300mg/m{\ell}$) could lead cancer cell to cell death. 2. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused DNA cleavage. 3. Lonicerae Flos herbal-acupuncture($400mg/m{\ell}$) caused apoptosis in the cancer cell line. According to above mentioned results, Lonicerae Flos Herbal- acupunctuer is expected bo by effective for anticancer response.

• Journal of Applied Biological Chemistry
• /
• 제49권3호
• /
• pp.86-89
• /
• 2006

The novel tetranuclear nickel (II) complex is a high rate accelerator in promoting hydrolysis of phosphate diesters. Nickel-bound bis-nitrophenyl phosphate (BNPP) can be $10^4$ times more reactive than the unbound BNPP. The large rate of enhancements by the complex slightly under basic condition has shown high catalytic activity in phosphate diester cleavage. The bell-shaped pH-rate profile indicated that the nickel-oxide form of the tetranuclear complex or its kinetic equivalent was the active species for cleaving BNPP. The catalytic hydrolysis between tetranuclear nickel (II) complex and phosphate diester proceeds via the formation of bidentate coordination of the anionic phosphate to the Ni (II) atom. This reveals that the complex has the possibility as artificial nuclease.

• 약학회지
• /
• 제39권6호
• /
• pp.689-694
• /
• 1995

Sphingolipids play important roles in cell regulation and signal transduction. Recently, a sphinogomyelin cycle has been described in which activation of neutral sphingomyelinase leads to the breakdown of sphingomyelin and the generation of ceramide. Ceramide, in turn, has emerged as a candidate intracellular mediator for the action of certain cell agonists and has multiple biologic actions. Ceramide is a potent suppressor of cell growth and an inducer of apoptosis. The present studies show that exposure of IM-9 cells to ceramide resulted in internucleosomal cleavage of DNA, yielding laddered patterns of oligonucleosomal fragments characteristic of apoptosis. DNA fragmentation induced by ceramide was also confirmed by diphenylamine assay. The effect of ceramide on cell cycle progression was also studied. The addition of ceramide increase G$_{1}$ phase distribution in cell cycle. Cell cycle-related cyclin D$_{1}$ gene expression was decreased in a time-dependent manner. These results suggest that apoptosis induced by ceramide is related to cell cycle associated with the alteration of cell cycle in IM-9 cells.

• 약학회지
• /
• 제45권5호
• /
• pp.484-490
• /
• 2001

Mylabris phalerata(MP) is an insect that has been used for the treatment of cancer in oriental medicine. To evaluate the anticancer activity of Mylabris phalerata, We measured the cytotoxicity of Mylabris phalerata solvent fractions such as MC, EA, BuOH and residual layers on U937, human monocytic leukemia cells. Of those fractions BuOH layer of Mylabris phalerata was the most effective with ID$_{50}$ of 140$\mu\textrm{g}$/ml. It effectively caused DNA fragmentation from the concentration of 50$\mu\textrm{g}$/ml, showed apoptotic nucleus by tenets assay and expressed apototic portion stained by Annexin-V. It also induced the activation of caspase-3 and cleavage of the substrate poly (ADP-ribose) polymerase (PARP). These results suggest BuOH layer of Mylabris phalerata exerts anticancer activity by induction of apoptosis via activation of caspase-3 protease.e.

• Clinical and Experimental Pediatrics
• /
• 제64권6호
• /
• pp.269-279
• /
• 2021

Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9 (CRISPR-Cas9) is an ancient prokaryotic defense system that precisely cuts foreign genomic DNA under the control of a small number of guide RNAs. The CRISPR-Cas9 system facilitates efficient double-stranded DNA cleavage that has been recently adopted for genome editing to create or correct inherited genetic mutations causing disease. Congenital heart disease (CHD) is generally caused by genetic mutations such as base substitutions, deletions, and insertions, which result in diverse developmental defects and remains a leading cause of birth defects. Pediatric CHD patients exhibit a spectrum of cardiac abnormalities such as septal defects, valvular defects, and abnormal chamber development. CHD onset occurs during the prenatal period and often results in early lethality during childhood. Because CRISPR-Cas9-based genome editing technology has gained considerable attention for its potential to prevent and treat diseases, we will review the CRISPR-Cas9 system as a genome editing tool and focus on its therapeutic application for CHD.

• 한국수정란이식학회지
• /
• 제16권2호
• /
• pp.73-78
• /
• 2001

본 연구는 한우 체외수정란에 외래 유전자를 미세현미 주입한 후 체외 배발달을 조사하였다. DNA 미세주입은 체외수정 18~20시간 후에 DNA를 미세주입하였으며 체외 배발달율은 7일간 배양 후 조사하였다. 미세현미 주입 후 난할율은 36.3%로 대조구의 난할율 66.4% 보다 유의적으로 낮았으며(p<0.05) DNA가 주입된 수정란 중 상실배와 배반포배까지 발달율은 각각 5.6%와 1.9%로 대조구의 20.5%와 12.8%에 비하여 유의적으로 낮게 나타났다. 체외발달 배양액 내 L-ascorbic acid와 $\alpha$-tocopherol 첨가 배양시 상실배와 배반포배 발달율이 대조구에 비하여 유의적으로 높게 나타났다.(p<0.05) 따라서 미세현미 주입된 수정란의 체외 배발달 배양액에 항산화제의 첨가는 높은 체외 배발달율을 얻을 수 있으며 또한 체외성숙과, 체외 수정된 한우수정란을 이용하여 형질전환 한우 생산이 가능하리라 사료된다.