Journal of Microbiology and Biotechnology

The Korean Society for Microbiology and Biotechnology (한국미생물·생명공학회)
권호 표지
DOI QR코드

DOI QR Code

Cloning, Expression, and Characterization of a Cold-Active and Organic Solvent-Tolerant Lipase from Aeromicrobium sp. SCSIO 25071

  • Su, Hongfei (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences) ;
  • Mai, Zhimao (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences) ;
  • Yang, Jian (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences) ;
  • Xiao, Yunzhu (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences) ;
  • Tian, Xinpeng (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences) ;
  • Zhang, Si (Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences)
  • Received : 2015.11.26
  • Accepted : 2016.03.08
  • Published : 2016.06.28
Download PDF
⟨ Previous Next ⟩

Abstract

The gene encoding lipase (Lip98) from Aeromicrobium sp. SCSIO 25071 was cloned and functionally expressed in Escherichia coli. Lip98 amino acid sequence shares the highest (49%) identity to Rhodococcus jostii RHA1 lipase and contains a novel motif (GHSEG), which is different from other clusters in the lipase superfamily. The recombinant lipase was purified to homogeneity with Ni-NTA affinity chromatography. Lip98 showed an apparent molecular mass of 30 kDa on SDS gel. The optimal temperature and pH value for enzymatic activity were recorded at 30℃ and 7.5, respectively. Lip98 exhibited high activity at low temperatures with 35% maximum activity at 0℃ and good stability at temperatures below 35℃. Its calculated activation energy was 4.12 kcal/mol at the low temperature range of 15-30℃. Its activity was slightly affected by some metal ions such as K+, Ca2+, and Na+. The activity of Lip98 was increased by various organic solvents such as DMSO, ethanol, acetone, and hexane with the concentration of 30% (v/v) and retained more than 30% residual activity in neat organic solvent. The unique characteristics of Lip98 imply that it is a promising candidate for industrial application as a nonaqueous biocatalyst and food additive.

Keywords

Introduction

Lipases (E.C. 3.1.1.3) are classic hydrolases that degrade triglycerides into diglycerides, monoglycerides, fatty acids, and glycerol [34]. Lipases also catalyze esterification, interesterification, and transesterification reactions in nonaqueous media. Although lipases are ubiquitous in animals, plants, and microorganisms, microbial lipases are the optimal sources for industrial application because they have more available catalytic activity, higher yield, easier genetic manipulation, more regular supply, and cheaper culture. Furthermore, microbial lipases are generally safer, more stable, and convenient because of the mild and controllable reaction conditions and the easily disposed residues [32].

As one of the most important enzymes, lipases play an important role in many industries involving food, detergent, pharmaceutical, leather, textile, cosmetic, paper, biodegradable polymer, and biodiesel [12,13]. One challenge in the application of lipases to industry is finding novel lipases with distinctive properties, including tolerance of organic solvents, high salt, alkaline conditions, and high enzymatic activity at low temperatures. Microbial cold-active lipases have attracted much attention because they are being increasingly applied to the synthesis of chiral intermediates. Effective catalysis at low temperatures is particularly favorable property for the production of temperature-sensitive compounds, and minimization of undesirable byproducts and enhancing enantioselectivity of chiral substances [14,21]. Furthermore, cold-active lipases can reduce the energy consumption of industrial processes. Cold-active lipases have shown tremendous potential as biocatalysts in biomedical applications, so they have raised researcher interest recently. Lipases are generally activated at the water/lipid interface [33]. Organic syntheses with lipases in organic solvents offer several advantages, including increasing the solubility of hydrophobic substrates and maintaining substrate specificity, shifting the equilibrium towards the desired direction, and enhancing stereoselectivity and regiospecificity [17]. Stability in organic solvents is necessary for lipases to catalyze organic synthesis and chiral resolution because such reactions require nonaqueous conditions.

Organic solvent-tolerant lipases from Candida, Pseudomonas, Mucor, Rhizopus, and Geotrichum sp. have been commercially applied [9], and several cold-active lipases have recently been reported. In preliminary work, Aeromicrobium sp. SCSIO 25071 that displayed high extracellular yield of and cold-active lipolytic activity was isolated from seawater of over 2,000 m depth in the Eastern Indian Ocean. In this study, a gene encoding lipase from Aeromicrobium sp. SCSIO 25071 was cloned and heterologously expressed in Escherichia coli for the further study. The purified lipase (Lip98) exhibited high activity at low temperatures and good stability in organic solvents. These properties make it great potential in industrial application, such as a nonaqueous biocatalyst and food additive.

 

Materials and Methods

Materials

Peptone, yeast extract, malt extract, glucose, and substrates p-nitrophenyl ester and p-nitrophenyl were obtained from Sigma-Aldrich (USA). A His-binding purification kit was purchased from Novagen (USA). Isopropyl-β-D-1-thiogalactopyranoside (IPTG), protein markers, and DNA purification kits were purchased from Transgene (China). The restriction endonucleases NcoI and HindIII, DNA polymerase LA-Taq, dNTPs, and T4 DNA ligase were purchased from Takara (China). All other chemicals used were of the highest analytical grade.

Homology search was performed by BLAST in LED (http://www.led.uni-stuttgart.de/). Multiple proteins were aligned with ClustalX and the ENDscript server (http://espript.ibcp.fr/ESPript/ESPript/) [27]. DNA and protein statistics were analyzed with a sequence manipulation suite. The three-dimensional structure of Lip98 was predicted by the M4T server (http://manaslu.aecom.yu.edu/ M4T/) and visualized by PyMol Viewer (http://www.pymol.org). The disulfide bridge was predict by Disulfide by Design ver. 1.20 (http://www.ehscenter.org/dbd/). The B-factor of the residues was calculated by B-FITTER (http://www.kofo.mpg.de/en/research/organic-synthesis).

Microorganism and Culture Conditions

The marine Aeromicrobium sp. SCSIO 25071 was isolated from seawater of 2,000 m depth in the Eastern Indian Ocean. The expressing host strain E. coli Rosetta (DE3) and pET-28a (+) vector were from Novagen (USA). The cloning host strain E. coli DH5α and pMD19-T vector were purchased from Takara (China).

Aeromicrobium sp. SCSIO 25071 was cultured in 2216E marine medium. E. coli strains were cultured in Luria–Bertani (LB) medium.

Methods

Cloning and sequencing of lipase gene

The harvested cells of Aeromicrobium sp. SCSIO 25071 were collected by centrifugation at 10,000 ×g after 3 days of shaking in 2216E marine medium. DNA was extracted according to a previously described method with slight modification [29]. According to the draft genome of Aeromicrobium sp. SCSIO 25071, a pair of primers were designed (GCGGCGCCATGGATCGCACACCTCGAGTCC TGGGAACGGTC, NcoI; and GGCCGAAGCTTGAGGATGTTG CCGACGAACGGCAGCAC, HindIII). The lipase gene was cloned by standard PCR technique using forward and reverse primers. The amplification fragment with a size of 969 bp was recovered by gel extraction and then ligated into the pMD19-T vector. The recombinant plasmid was transformed into E. coli DH5α using the heat-shock method. The putative lipase gene was sequenced by Beijing Genomics Institute (BGI, China). The linearized expression vector pET-28a and the putative lipase gene were recovered by gel exaction after digestion by restriction enzymes NcoI and HindIII, and then ligated with T4 ligase at 16℃ for 16 h. The recombinant expression plasmid was transformed into E. coli Rosetta (DE3) using the heat-shock method.

Expression of Lipase Gene in E. coli Rosetta (DE3)

The recombinant E. coli Rosetta (DE3) cells were cultured on LB agar medium containing kanamycin (50 mg/ml), overnight at 37℃. A positive colony was screened to inoculate in 5 ml of LB broth containing kanamycin (50 mg/ml) for overnight incubation at 37℃ and 150 rpm. Overnight cultures were used to inoculate 200 ml of LB medium supplemented with 50 mg/ml kanamycin and were grown aerobically at 37℃. When the OD600 of the bacterial culture reached 0.6–0.8, IPTG at a final concentration of 1 mM was added for further induction for 20 h at 22℃.

Purification and Identification of Lipase

After induction for 20 h, recombinant cells were harvested by centrifugation at 6,000 ×g and 4℃ for 20 min, washed twice, and suspended in 20 ml of Tris-HCl (20 mM, pH 8.0). After sonication (5 sec, 150 w, 4℃ for 20 min) and centrifugation (10,000 ×g, 20 min in 4℃), the supernatant containing the recombinant lipase was loaded onto a Ni2+-NTA agarose affinity column. The recombinant protein was eluted with elution buffer (20 mM Tris–HCl, pH 8, 200 mM imidazole) and was immediately diluted 3-fold with deionized double-distilled H2O pre-chilled to 4℃. The purity of the protein was analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and the protein concentration was measured using the Bradford method [3] with bovine serum albumin as the standard.

The lipolytic activity and positional specificity of the recombinant enzyme were identified by assessing its ability to hydrolyze water-insoluble ester bondings of tri-, di-, and monoglycerides into fatty acids and glycerol [5]. The mixture, consisting of 0.9 ml of triolein emulsion (properly mixed of an equal volume triolein with 20 mM Tris–HCl buffer, pH 7.5) and 100 μl of purified lipase diluted properly, was incubated at 28℃ under 200 rpm shaking. The products were extracted by adding 1 ml of n-hexane at 0, 1, 3, and 6 h, and were analyzed by thin-layer chromatography. They were separated on a HPTLC silica gel plate (10 × 10 cm, F254; Merck, Germany) using chloroform and acetone (96:4) as the mobile phase. Spots of products were visualized with iodine vapor, and monoolein, 1,2(2,3)-diolein, 1,3-diolein, oleic acid, and triolein were used as the reference glycerides [22].

Lipase Activity and Substrate Specificity Assay

According to a report of Pencrench and Baratti [26] with small modifications, the activity of lipase assay was carried out in a 1 ml reaction mixture containing 100 μl of p-nitrophenyl palmitate diluted in isopropanol (10 mM), 890 μl of Tris-HCl buffer (50 mM Tris–base, pH 8.0, 0.4% Triton X-100, and 0.1% gum arabic), and 10 μl of lipase elution diluted properly. The amount of p-nitrophenol was quantified by a spectrophotometer at 410 nm after stopping the reaction using 10% SDS. One unit (IU) of lipase activity was defined as the required amount of enzyme to release 1 μM of p-nitrophenyl per minute. The substrate specificity was detected with various p-nitrophenyl esters with different acyl chains (p-nitrophenol acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl caproate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl decanoate (C10), p-nitrophenyl laurate (C12), and p-nitrophenol palmitate (C16)) as substrate according to the standard assay. The hydrolytic assay of the purified enzyme towards triacylglyceride was also determined using tributyrin (C4), tricaprylin (C8), tripalmitin (C16), and triolein (C18:1) as substrate. All the experiments were performed in triplicates.

Determination of pH and Temperature Profiles

To investigate the effects of pH and temperature on the lipase activity, the reactions were established in different buffers having pH value ranging from 5.0-8.5 (Phosphate buffer) and 8.5-11.0 (Glycine-NaOH buffer) followed by lipase assay at different temperatures ranging from 0 to 60℃. The recombinant lipase was pre-incubated in buffers (1:5 (v/v)) of different pH range of 5.0-11.0 at room temperature for 30 min, and the activity was measured with the standard assay to evaluate the pH stability. For the thermostable experiments, aliquots were withdrawn to measure the residual activity at different time intervals (0, 10, 30, 60, 90, and 120 min) during enzyme pre-incubating in phosphate buffer (pH 8) at 25℃, 35℃, 45℃, and 55℃ for 120 min.

Effects of Metal Ions, Inhibitors, and Detergents on Lipase Activity

The effects of metal ions, inhibitors, and detergents on the lipase activity were carried out by pre-incubating the recombinant lipase in the optimal pH buffer containing 1 mM and 10 mM metal ions (NaCl, KCl, NH4Cl, MgCl2, ZnCl2, CaCl2, MnCl2, CuCl2, NiCl2, BaCl2, and FeCl3), 1 mM inhibitors (EDTA, PMSF, and 1,10-phenanthroline), and 1% (w/v) detergents (Tween 60, Tween 80, TritonX-100) at 25℃ for 30 min. After initiating the reaction by adding substrate and incubating for 10 min, the enzyme activities were measured with the standard test, with the template activity without any ions or detergents as the control (100%).

Effect of Organic Solvents on Lipase Activity

The effect of organic solvents on the lipase activity was investigated following pre-incubation of recombinant lipase at 25℃ in the presence of different organic solvents (ethanol, acetone, acetonitrile, DMSO, n-hexanol, tertiary butanol, toluene, and hexane) with concentrations of 30% (0.7 ml enzyme solution in 0.3 ml organic solvent), 50% (0.5 ml enzyme solution in 0.5 ml organic solvent), and 100% (v/v) (0.5 ml enzyme solution lyophilized into power and added to 1 ml organic solvent), respectively. The residual activity was measured after pre-incubating at 3 and 12 h, respectively. All the experiments were performed in triplicates.

Sequence Accession Number

The nucleotide sequence of the gene encoding lipase was named Lip98 and deposited to GenBank as Accession No. KR996514.

 

Results and Discussion

Cloning and Sequence Analysis of the Lipase Gene

The lipase gene was amplified from genomic DNA of Aeromicrobium sp. SCSIO 25071 and designated as Lip98. The putative lipase-encoding gene contained a complete open reading frame of 969 bp, encoding a polypeptide with 323 aa residues. The calculated mass of the recombinant lipase was approximately 30.8 kDa with a theoretical pI of 4.82. The cleavage site of the putative signal peptide was analyzed and located between Ala-27 and Gln-28 by SignalP4.0 [20]. No sequence of the triacylglycerol lipase gene shared identity to the Lip98 gene through BLAST gene search in NCBI. BLASTp of Lip98 in LED (the Lipase Engineering Database) showed 49%, 48%, and 36% identity to the sequences of lipases from Rhodococcus jostii RHA1, Frankia sp. EAN1pec, and Salinispora arenicola CNS-205 respectively. Sequence alignments (Fig. 1) revealed that the active serine residue and oxyanion hole residue of Lip98 are situated at the center of a unique penta-peptide motif (GHSEG), which is distinguished from the known motifs conserved in 14 known lipase families [1]. The catalytic triads of Lip98 were formed by Ser156-Asp254-His284. Lipases possess the complete catalytic machinery, consisting of the catalytic triad and two oxyanion hole residues [1].

Fig. 1.Alignment of amino acid sequences of lipase and the representatives from Rhodococcus jostii RHA1, Frankia sp. EAN1pec, and Salinispora arenicola CNS-205. (▲) Amino acid residues belonging to the catalytic triad. (The bigger closed circle contained Ser156) The conserved penta-peptide motif. The positions of the alpha-helix (α), beta-strand (β), and turn (T).

Expression, Purification, and Identification of Lipase

The gene encoding Lip98 was successfully expressed in E. coli Rosetta (DE3). The crude recombinant lipase was purified via Ni-NTA affinity chromatography (Table 1). SDS-PAGE analysis showed that Lip98 was purified to homogeneity and its molecular mass corresponding to the calculated mass was approximately 30 kDa (Fig. 2A). As shown in Fig. 2B, the purified enzyme was able to hydrolyze triolein into monoolein, 1,2(2,3)-diolein, 1,3-diolein, oleic acid, and glycerol, exhibiting no specific regioselectivity. Because this enzyme had high activity towards long-chain glycerides, it is referred to as a true lipase and was designated as Lip98.

Fig. 2.Purification and hydrolysis activity of Lip98. A. 10% SDS-PAGE analysis of the purified Lip98. Lanes 1, cell lysate of E. coli harboring empty pET-28a (+) induced with IPTG; 2, recombinant E. coli harboring pET- lip98 induced with IPTG; 3, purified Lip98; M, protein marker. B. Product of triolein hydrolysis by Lip98. 1, 0 h reaction time ; 2, 3 h reaction time; 3, 6 h reaction time; 4, Reference by triolein, monoolein, 1,2(2,3)-diolein, 1,3-diolein, oleic acid, and glycerol.

Table 1.Summary of the purification of Lip98.

pH and Temperature Profiles

As shown in Fig. 3, the optimal pH for Lip98 was determined to be 7.5, which is similar to those of cold-active lipases from Pseudoalteromonas sp. wp27 and Psychrobacter sp. wp37, of which the optimal pHs approach 8.0 [38]. Lip98 showed 70% of its maximum hydrolytic activity in the pH range of 7.0-8.5, and was stable across a broad pH range (pH 6.0-10.0).

Fig. 3.Effect of pH on Lip98 activity and stability. The activity of Lip98 was determined at 30℃ from pH 5.0 to 10.0 (solid line). The pH stability of Lip98 was measured by pre-incubating the enzyme at different buffers of pH 5.0-11.0 for 3 h at room temperature (dashed line). Phosphate buffer (■) and Glycine-NaOH buffer (●). The error bars represent the means ± SD (n = 3). The maximal activity was taken as 100%.

With regard to temperature (Figs. 4A and 4B), Lip98 displayed high activity in the temperature range of 25-45℃, with maximum activity at 30℃, and retained 35% of its maximum activity at 0℃. Keeping high activity at low temperatures is the typical characteristic of cold-active lipases [10,19,23]. The values of Km and kcat of Lip98 for pNPp at 30℃ were determined to be 0.545 mM and 30.5 s-1 respectively. Based on the Arrhenius equation, the activation energy was calculated to be 4.12 kcal/mol in the temperature range 15-30℃. Kinetic and thermodynamic parameters of the five lipases are listed in Table 2. Its low value was approaching to that of BPL3 (4.26 kcal/mol) [18], but lower than other cold-active enzymes such as BPL1 (5.32 kcal/mol) and MBP lipase (5.5 kcal/mol) [24]. This implies that Lip98 conducts efficient catalysis at low temperature. Lip98 was stable after 120 min of incubation at temperatures below 35℃, maintaining 70% of its original activity, although it was unstable at temperatures above 45℃, losing nearly all activity after incubation at 55℃ for 120 min. The t1/2 at 55℃ was calculated to be 8.5 min, which is longer than other cold-active lipases [7,24].

Fig. 4.Effect of temperature on Lip98 activity and thermostability. The maximal activity was taken as 100%. The error bars represent the means ± SD (n = 3). (A) The activity of Lip98 was determined in Phosphate buffer (pH 7.5) at different temperature. (B) The thermostability was assayed by pre-incubating Lip98 at different temperatures and measured at different time intervals. The error bars represent the means ± SD (n = 3). 25℃ (●), 35℃ (▲), 45℃ (△), 55℃ (○).

Table 2.Comparison of kinetic and thermodynamic parameters of Lip98 and other lipases.

Sequence analysis showed that Lip98 had a small amount of residues (Glu, Lys, Arg) involved in the stability of intramolecular salt bridges [14]. The three-dimensional structure of Lip98 was predicted using multimodel homology modeling by the M4T server and visualized by PyMol Viewer software (Fig. 5). Analysis of the disulfide of Lip98 by Design ver. 1.20 showed it contained four cysteines and they may only form one disulfide bridge (Cys250-Cys284) for contribution to the stability of the enzyme [4]. The B factor of some residues of Lip98 were predicted to be high (>20.0). The previous literature reported that a higher B-factor indicates a lower stability of the enzyme [25] and the B-factor of some residues of Lip98 were predicted to be high (>20.0). Lip98 has a relative longer NC-loop (links the β5 sheet and lid domain) than thermophilic lipase [15]. The longer NC-loop may increase its flexibility which makes it more easier to regulate the movement between the lid and catalysis domain at low temperature. These structural features may lead to Lip98 exhibiting high activity at low temperature and low thermostability. This indicates that Lip98 is a genuine cold-active lipase. With its cold-active characteric, it may be used efficiently as a valuable biocatalyst in food such as polyunstructured fatty acids, which are under lowest temperature to protect them from oxidization.

Fig. 5.3D structure of Lip98. The α-helix, β-sheet, random coil, and beta turn are in cyan, magenta, and tints, respectively. The catalytic triad is labeled with blue sticks, and the NC-loop is in red from Ile181 to Thr206.

Effects of Metal Ions, Inhibitors, and Detergents on the Lipase Activity

The effects of metal ions, inhibitors, and detergents on the activity of lipase are shown in Fig. 6. Most reagents with 1 mM had slight effect on the activity of Lip98 (82.6%-123.5%), except for Zn2+, which sharply reduced the activity by 25.9%. In contrast, 10 mM Zn2+, Ni2+, and Co2+ absolutely inhibited the enzymatic activity. Detergents such as Tween 60, Tween 80, and SDS with 1% (w/v) inhibited activity. In previous reports, the activity of some lipases are sharply diminished by PMSF and 10-phenanthroline [11,30], but Lip98 retained almost 100% activity in the presence of these additives. Additionally, EDTA had no significant effect on the activity, suggesting Lip98 is not a metalloenzyme.

Fig. 6.Effect of metal ions, chemical reagents, and substrate chain length on the activity of Lip98. Assays were performed under optimum conditions. Values represent the mean ± SD (n = 3) relative to the untreated control samples. The activity measured without additives was defined as 100%.

Effects of Organic Solvents on Lipase Activity

As presented in Table 3, the stability of Lip98 in various polar and nonpolar organic solvents was investigated. Compared with reactions performed in water-based condition(s), there are numerous advantages when performed in organic solvent condition(s), including enhancing the enzymatic activity, stability, stereoselectivity, and regiospecificity, shifting the equilibrium towards the desired direction, and making recovery much easier [31]. Although bacterial and fungal lipases are rarely stable in hydrophilic organic solvents [16], Lip98 activity was increased after incubation (at 25℃ for 3 h) in 30% (v/v) polar organic solvents (DMSO, ethanol, and acetone). Compared with lipases from Burkholderia ambifaria YCJ01 [37] and Galactomyces geotrichum Y05 [36], Lip98 showed no obvious preference for the polarity of the organic solvent, so it may have more potential for organic synthesis. Lip98 activity was also increased in 50% (v/v) toluene and hexane. It retained more than 30% residual activity in all neat organic solvents. It is interesting that Lip98 retained 100% activity after incubation for 3 and 12 h in 100% (v/v) hexane, which was broadly used as a solvent for lipase to efficiently catalyze the transesterification and interesterification for synthesis of flavor esters, sugar esters, thiol esters, and fatty amides [2,6,8,28]. Some research on organic solvent-tolerant and cold-active lipases has been reported [16,35], but this is the first study to report on a cold-active organic solvent-tolerant lipase from Aeromicrobium sp.

Table 3.aLog P is the logarithm of the partition coefficient of the solvent between n-octanol and water, and is used as a quantitative measure of the solvent polarity. bAssay was performed under optimum conditions. cValues represent the mean ± SD (n = 3) relative to the untreated control samples. dThe activity measured without organic solvent was defined as 100%.

Substrate Specificity

The reaction of Lip98 towards various p-nitrophenyl esters was examined at 30℃ and pH 7.5. As shown in Fig. 7, Lip98 displayed different substrate specificity toward synthetic p-nitrophenyl esters. It could hydrolyze various p-nitrophenyl esters with different chain lengths (C2, C4, C6, C8, C12, C14, C16), having the highest activity on p-nitrophenyl palmitate (C16), on top of p-nitrophenyl butyrate (C4). With the substrate as various triglycerides, Lip98 exhibited highest activity toward tripalmitin (C16), followed by tributyrin (C8) and triolein (C18:1). Lip98 exhibited significant activity toward long-chain triglycerides, indicating it was a true lipase. These studies demonstrate that Lip98 is a true lipase but not an esterase.

Fig. 7.Substrate specificity of Lip98. The lipase activity of the purified recombinant enzyme Lip98 toward various chain lengths of p-NP esters and triacyglyceride was assayed at 30℃, pH 7.5. The highest level of activity with the substrate was taken as 100%. The error bars represent the means ± SD (n = 3).

In conclusion, in this study, a new gene encoding a new lipase (Lip98) from Aeromicrobium sp. was cloned and expressed in E. coli DH5α and E. coli Rosetta (DE3), respectively. The recombinant enzyme was then purified and characterized. Lip98 contained a unique penta-peptide motif (GHSEG), which is distinguished from the known motifs conserved in 14 known lipase families. Lip98 exhibited cold-active property with high activity in low temperature (35% activity at 0℃), and displayed good organic solvent tolerance with high activity and good stability against a variety of organic solvents (>30% in neat organic solvent). These distinguishing characteristics proved that Lip98 has the potential in industrial application as a nonaqueous biocatalyst and food additive.

References

  1. Arpigny JL, Jaeger KE. 1999. Bacterial lipolytic enzymes: classification and properties. Biochem. J. 343: 177-183. https://doi.org/10.1042/bj3430177
  2. Basheer S, Mogi K, Nakajima M. 1995. Interesterification kinetics of triglycerides and fatty-acids with modified lipase in n-hexane. J. Am. Oil Chem. Soc. 72: 511-518. https://doi.org/10.1007/BF02638850
  3. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 7. https://doi.org/10.1016/0003-2697(76)90527-3
  4. Brumlik MJ, van der Goot FG, Wong KR, Buckley JT. 1997. The disulfide bond in the Aeromonas hydrophila lipase/acyltransferase stabilizes the structure but is not required for secretion or activity. J. Bacteriol. 179: 3116-3121. https://doi.org/10.1128/jb.179.10.3116-3121.1997
  5. Casas-Godoy L, Duquesne S, Bordes F, Sandoval G, Marty A. 2012. Lipases: an overview. Methods Mol. Biol. 861: 3-30.
  6. Chulalaksananukul W, Condoret JS, Delorme P, Willemot RM. 1990. Kinetic-study of esterification by immobilized lipase in n-hexane. FEBS Lett. 276: 181-184. https://doi.org/10.1016/0014-5793(90)80537-S
  7. Cui SS, Lin XZ, Shen JH. 2011. Effects of co-expression of molecular chaperones on heterologous soluble expression of the cold-active lipase Lip-948. Protein Expr. Purif. 77: 166-172. https://doi.org/10.1016/j.pep.2011.01.009
  8. Daneshfar A, Ghaziaskar HS, Shiri L, Manafi MH, Nikorazm M, Abassi S. 2007. Synthesis of 2-ethylhexyl-2-ethylhexanoate catalyzed by immobilized lipase in n-hexane: a kinetic study. Biochem. Eng. J. 37: 279-284. https://doi.org/10.1016/j.bej.2007.05.007
  9. Ertugrul S, Donmez G, Takac S. 2007. Isolation of lipase producing Bacillus sp. from olive mill wastewater and improving its enzyme activity. J. Hazard. Mater. 149: 720-724. https://doi.org/10.1016/j.jhazmat.2007.04.034
  10. Florczak T, Daroch M, Wilkinson MC, Bialkowska A, Bates AD, Turkiewicz M, Iwanejko LA. 2013. Purification, characterisation and expression in Saccharomyces cerevisiae of LipG7 an enantioselective, cold-adapted lipase from the Antarctic filamentous fungus Geomyces sp. P7 with unusual thermostability characteristics. Enzyme Microb. Technol. 53: 18-24. https://doi.org/10.1016/j.enzmictec.2013.03.021
  11. Glogauer A, Martini VP, Faoro H, Couto GH, Muller-Santos M, Monteiro RA, et al. 2011. Identification and characterization of a new true lipase isolated through metagenomic approach. Microb. Cell Fact. 10: 54-68. https://doi.org/10.1186/1475-2859-10-54
  12. Hasan F, Shah AA, Hameed A. 2006. Industrial applications of microbial lipases. Enzyme Microb. Technol. 39: 235-251. https://doi.org/10.1016/j.enzmictec.2005.10.016
  13. Houde A, Kademi A, Leblanc D. 2004. Lipases and their industrial applications - An overview. Appl. Biochem. Biotechnol. 118: 155-170. https://doi.org/10.1385/ABAB:118:1-3:155
  14. Joseph B, Ramteke PW, Thomas G. 2008. Cold active microbial lipases: some hot issues and recent developments. Biotechnol. Adv. 26: 457-470. https://doi.org/10.1016/j.biotechadv.2008.05.003
  15. Li B, Yang G, Wu L, Feng Y. 2012. Role of the NC-loop in catalytic activity and stability in lipase from Fervidobacterium changbaicum. PLoS One 7: e046881.
  16. Li M, Yang LR, Xu G, Wu JP. 2013. Screening, purification and characterization of a novel cold-active and organic solvent-tolerant lipase from Stenotrophomonas maltophilia CGMCC 4254. Bioresour. Technol. 148: 114-120. https://doi.org/10.1016/j.biortech.2013.08.101
  17. Lima VMG, Krieger N, Mitchell DA, Baratti JC, de Filippis I, Fontana JD. 2004. Evaluation of the potential for use in biocatalysis of a lipase from a wild strain of Bacillus megaterium. J. Mol. Catal. B Enzym. 31: 53-61. https://doi.org/10.1016/j.molcatb.2004.07.005
  18. Litantra R, Lobionda S, Yim JH, Kim HK. 2013. Expression and biochemical characterization of cold-adapted lipases from Antarctic Bacillus pumilus strains. J. Microbiol. Biotechnol. 23: 1221-1228. https://doi.org/10.4014/jmb.1305.05006
  19. Maharana A, Ray P. 2015. A novel cold-active lipase from psychrotolerant Pseudomonas sp. AKM-L5 showed organic solvent resistant and suitable for detergent formulation. J. Mol. Catal. B Enzym. 120: 173-178. https://doi.org/10.1016/j.molcatb.2015.07.005
  20. Nielsen H, Engelbrecht J, Brunak S, von Heijne G. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10: 1-6. https://doi.org/10.1093/protein/10.1.1
  21. Normand P, Lapierre P, Tisa LS, Gogarten JP, Alloisio N, Bagnarol E, et al. 2007. Genome characteristics of facultatively symbiotic Frankia sp. strains reflect host range and host plant biogeography. Genome Res. 17: 7-15. https://doi.org/10.1101/gr.5798407
  22. Ogino H, Nakagawa S, Shinya K, Muto T, Fujimura N, Yasuda M, Ishikawa H. 2000. Purification and characterization of organic solvent-stable lipase from organic solvent-tolerant Pseudomonas aeruginosa LST-03. J. Biosci. Bioeng. 89: 451-457. https://doi.org/10.1016/S1389-1723(00)89095-7
  23. Parra LP, Espina G, Devia J, Salazar O, Andrews B, Asenjo JA. 2015. Identification of lipase encoding genes from Antarctic seawater bacteria using degenerate primers: expression of a cold-active lipase with high specific activity. Enzyme Microb. Technol. 68: 56-61. https://doi.org/10.1016/j.enzmictec.2014.10.004
  24. Parra LP, Reyes F, Acevedo JP, Salazar O, Andrews BA, Asenjo JA. 2008. Cloning and fusion expression of a cold-active lipase from marine Antarctic origin. Enzyme Microb. Technol. 42: 371-377. https://doi.org/10.1016/j.enzmictec.2007.11.003
  25. Parthasarathy S, Murthy MRN. 2000. Protein thermal stability: insights from atomic displacement parameters (B values). Protein Eng. 13: 9-13. https://doi.org/10.1093/protein/13.1.9
  26. Pencreach G, Baratti JC. 1996. Hydrolysis of p-nitrophenyl palmitate in n-heptane by the Pseudomonas cepacia lipase: a simple test for the determination of lipase activity in organic media. Enzyme Microb. Technol. 18: 417-422. https://doi.org/10.1016/0141-0229(95)00120-4
  27. Robert X, Gouet P. 2014. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 42: W320-W324. https://doi.org/10.1093/nar/gku316
  28. Romero MD, Calvo L, Alba C, Daneshfar A. 2007. A kinetic study of isoamyl acetate synthesis by immobilized lipase-catalyzed acetylation in n-hexane. J. Biotechnol. 127: 269-277. https://doi.org/10.1016/j.jbiotec.2006.07.009
  29. Sambrook J, Russell D. 2001. Molecular Cloning: A Laboratory Manual. Coldspring Harbor Laboratory Press, Cold Spring Harbor, New York.
  30. Shariff FM, Abd Rahman RNZR, Basri M, Salleh AB. 2011. A newly isolated thermostable lipase from Bacillus sp. Int. J. Mol. Sci. 12: 2917-2934. https://doi.org/10.3390/ijms12052917
  31. Sharma S, Kanwar SS. 2014. Organic solvent tolerant lipases and applications. Scientific World J. 2014: 625258.
  32. Street G. 1977. Handbook of enzyme biotechnology. Biochem. Educ. 5: 64. https://doi.org/10.1016/0307-4412(77)90054-1
  33. Tran DT, Lin YJ, Chen CL, Chang JS. 2013. Kinetics of transesterification of olive oil with methanol catalyzed by immobilized lipase derived from an isolated Burkholderia sp. strain. Bioresour. Technol. 145: 193-203. https://doi.org/10.1016/j.biortech.2013.01.146
  34. Treichel H, de Oliveira D, Mazutti MA, Di Luccio M, Oliveira JV. 2009. A review on microbial lipases production. Food Bioprocess Technol. 3: 182-196. https://doi.org/10.1007/s11947-009-0202-2
  35. Ugur A, Boran R. 2014. Production and characterization of a cold-active and n-hexane activated lipase from a newly isolated Serratia grimesii RB06-22. Biocatal. Biotransformation 32: 222-230. https://doi.org/10.3109/10242422.2014.934684
  36. Yan JY, Yang HK, Xu L, Yan YJ. 2007. Gene cloning, overexpression and characterization of a novel organic solvent tolerant and thermostable lipase from Galactomyces geotrichum Y05. J. Mol. Catal. B Enzym. 49: 28-35. https://doi.org/10.1016/j.molcatb.2007.07.006
  37. Yao CJ, Cao Y, Wu SS, Li S, He BF. 2013. An organic solvent and thermally stable lipase from Burkholderia ambifaria YCJ01: purification, characteristics and application for chiral resolution of mandelic acid. J. Mol. Catal. B Enzym. 85-86: 105-110. https://doi.org/10.1016/j.molcatb.2012.08.016
  38. Zeng X, Xiao X, Wang P, Wang FP. 2004. Screening and characterization of psychrotrophic, lipolytic bacteria from deep-sea sediments. J. Microbiol. Biotechnol. 14: 952-958.

Cited by

  1. Cloning, Expression, and Characterization of a Cold-Adapted Shikimate Kinase from the Psychrophilic Bacterium Colwellia psychrerythraea 34H vol.26, pp.12, 2016, https://doi.org/10.4014/jmb.1608.08049
  2. New lipases by mining of Pleurotus ostreatus genome vol.12, pp.9, 2016, https://doi.org/10.1371/journal.pone.0185377
  3. 유기용매 내성 리파아제와 그 이용가능성 vol.27, pp.11, 2017, https://doi.org/10.5352/jls.2017.27.11.1381
  4. Microbial lipase production: A deep insight into the recent advances of lipase production and purification techniques vol.68, pp.3, 2021, https://doi.org/10.1002/bab.2019
  5. Biotechnological potential of psychrophilic microorganisms as the source of cold-active enzymes in food processing applications vol.11, pp.11, 2016, https://doi.org/10.1007/s13205-021-03008-y