Journal of Microbiology and Biotechnology

The Korean Society for Microbiology and Biotechnology (한국미생물·생명공학회)
권호 표지
DOI QR코드

DOI QR Code

Function of Global Regulator CodY in Bacillus thuringiensis BMB171 by Comparative Proteomic Analysis

  • Qi, Mingxia (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Mei, Fei (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Wang, Hui (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Sun, Ming (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Wang, Gejiao (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Yu, Ziniu (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University) ;
  • Je, Yeonho (School of Agricultural Biotechnology, College of Agriculture and Life Sciences, Seoul National University) ;
  • Li, Mingshun (State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University)
  • Received : 2014.06.12
  • Accepted : 2014.09.12
  • Published : 2015.02.28
⟨ Previous Next ⟩

Abstract

CodY is a highly conserved protein in low G+C gram-positive bacteria that regulates genes involved in sporulation and stationary-phase adaptation. Bacillus thuringiensis is a grampositive bacterium that forms spores and parasporal crystals during the stationary phase. To our knowledge, the regulatory mechanism of CodY in B. thuringiensis is unknown. To study the function of CodY protein in B. thuringiensis, BMB171codY- was constructed in a BMB171 strain. A shuttle vector containing the ORF of cry1Ac10 was transformed into BMB171 and BMB171codY-, named BMB171cry1Ac and BMB171codY-cry1Ac, respectively. Some morphological and physiological changes of codY mutant BMB171codY-cry1Ac were observed. A comparative proteomic analysis was conducted for both BMB171codY-cry1Ac and BMB171cry1Ac through two-dimensional gel electrophoresis and MALDI-TOF-MS/MS analysis. The results showed that the proteins regulated by CodY are involved in microbial metabolism, including branched-chain amino acid metabolism, carbohydrate metabolism, fatty acid metabolism, and energy metabolism. Furthermore, we found CodY to be involved in sporulation, biosynthesis of poly-β-hydroxybutyrate, growth, genetic competence, and translation. According to the analysis of differentially expressed proteins, and physiological characterization of the codY mutant, we performed bacterial one-hybrid and electrophoretic mobility shift assay experiments and confirmed the direct regulation of genes by CodY, specifically those involved in metabolism of branched-chain amino acids, ribosomal recycling factor FRR, and the late competence protein ComER. Our data establish the foundation for in-depth study of the regulation of CodY in B. thuringiensis, and also offer a potential biocatalyst for functions of CodY in other bacteria.

Keywords

Introduction

CodY is a highly conserved regulatory protein in low G+C gram-positive bacteria that regulates many virulence genes in pathogenic microorganisms [12,14,26]. IDAP-Seq methods (genome-wide identification of protein-binding regions in vitro) have been used successfully to identify CodY-regulated genes in Bacillus subtilis, Staphylococcus aureus, Clostridium difficile, and Bacillus anthracis [2,7,14,29]. It has been demonstrated that CodY regulates genes involved in the degradation of macromolecules, transport of nutrients, microbial metabolism, antibiotic synthesis, and chemotaxis [3,23,30]. CodY is a dimeric protein that contains a winged helix-turn-helix DNA-binding motif and ligand-binding GAF domain [26]. The effectors of CodY are GTP and the branched-chain amino acids (BCAAs) isoleucine, leucine, and valine. GTP and BCAAs increase synergistically the affinity of CodY for its DNA target sites [20,42].

Current research on CodY focuses mainly on binding sites, effectors, and the regulation of many virulence genes in B. subtilis and some pathogenic microorganisms, including S. aureus, C. difficile, and B. anthracis [2,7,12,14,26,29]. In contrast, the regulatory mechanisms of CodY in B. thuringiensis, the primary bacterial entomopathogen that produces proteinaceous parasporal crystalline toxin inclusions used in biocontrol worldwide, is unknown. To study the function of CodY protein in B. thuringiensis, a codY knockout B. thuringiensis strain, BMB171codY-, was constructed in the BMB171 strain. A shuttle vector containing the ORF of cry1Ac10 was transformed into BMB171 and BMB171codY-, named BMB171cry1Ac and BMB171codY-cry1Ac, respectively. In order to understand the physiological consequences of codY deletion at the proteomic level, and the relationship between CodY and insecticidal crystal proteins, we performed 2-DE and MALDI-TOF-MS/MS analysis of BMB171cry1Ac and BMB171codY-cry1Ac. A total of 36 differentially expressed proteins were identified as being involved with metabolism. Altogether, our results strongly suggest that CodY regulates proteins involved in metabolic activity, as well as sporulation, growth, translation, and genetic competence, in B. thuringiensis. These results establish the foundation for fully understanding the regulation between CodY and formation of spore and insecticidal crystal proteins in B. thuringiensis.

 

Materials and Methods

Bacterial Strain and Culture Conditions

In this study, we used bacterial strains B. thuringiensis BMB171, a plasmid-cured, acrystalliferous strain [27]; Escherichia coli DH5α; and E. coli BL21. Each was grown in Luria–Bertani (LB) broth or on LB agar plates. E. coli strains D H5α and BL21 were grown at 37℃. The B. thuringiensis strains were grown at 28℃. Peptone medium (per liter culture medium contains peptone 10 g, glucose 5 g, yeast extract 2 g, KH2PO4 1 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.02 g, ZnSO4·7H2O 0.02 g, and MnSO4·7H2O 0.02 g) was used to quickly induce spore formation in B. thuringiensis.

Construction of codY Knockout Mutant BMB171codY-cry1Ac

Using Taq DNA polymerase (Takara Biotechnology, China), an upstream region and a downstream region of the codY gene were amplified from BMB171 genomic DNA with the primer pairs P1 (5’AGTGAATTCTACAAGGGAGATTTCCGATTC)/P2 (5’ATTGGATCCACCTAGACGCTCACCGCCAC) and P3 (5’CGCGGATCCTATTAGCTCGTCTTGGTC)/P4 (5’GCTCTAGAGCATTCTTTCGATGTCTT). The amplified fragments were 1.0 and 1.1 kb in length. To construct the knockout vector pBMB0413, both fragments and the spectinomycin-resistant gene (1.6 kb) were inserted into the multiple cloning sites of temperature-sensitive carrier pHT304-TS [1]. BMB171 was transformed with pBM0413. The codY knockout mutant was screened for erythromycin and spectinomycin resistance under incubation at 42℃. A resulting clone was chosen and named as BMB171codY-. Shuttle vector pBMB43-304 containing the ORF of insecticidal crystal protein gene cry1Ac10 was used to transform BMB171 and BMB171codY-, named BMB171cry1Ac and BMB171codY-cry1Ac, respectively.

Flasks containing 50 ml of culture medium were incubated at 28℃. Cell samples were taken and measured at every 2 h. We determined the cell growth curve at each time point by measuring the optical density at 600 nm using a Shimadzu UV-1201 spectrophotometer (Osaka, Japan). The growth curve was prepared with the mean optical densities of triplicate bacterial cultures at each time point. The plate counting dilution method was also used to determine the growth curves of BMB171cry1Ac and BMB171codY-cry1Ac. The appropriate dilution degree of bacteria liquid was made in order to guarantee the plate had 30-300 bacterial colonies.

Transmission Electron Microscopic Observation

The bacterial pellets from cultures of BMB171cry1Ac and BMB171codY-cry1Ac after 28 h were harvested by centrifugation at 10,000 ×g at 4℃ for 5 min. In brief, the pellets were washed with phosphate-buffered saline (PBS), and suspended in 0.1 M Sorensen buffer containing 2.5% (v/v) glutaraldehyde. After fixation, dehydration, embedding, and ultrathin sectioning were performed. Sections were stained in 1% (w/v) uranyl acetate and lead citrate solution. The stained samples were examined using FEI Tecnai G2 20 TWIN (Portland, OR, USA) operating at 80 kV.

Determination of PHB Concentration and SDS-PAGE Analysis

We determined the bacterial poly-β-hydroxybutyrate (PHB) content by the spectrophotometric method described by Law and Slepecky [25].

For protein extraction, we collected cells representing different growth phases, specifically 7, 10, and 22 h, and 12, 20, and 30 h for strains BMB171cry1Ac and BMB171codY-cry1Ac, respectively. Bacterial cultures were boiled for 10 min. The cell debris was removed by centrifugation at 10,000 ×g for 5 min. The samples were subjected to 12% SDS–PAGE and stained using Coomassie blue [17].

2-D Protein Electrophoresis and Image Generation

We collected protein samples representing the mid-log phase, early-stationary phase, and late-stationary phase at 7, 10, and 19 h, and 12, 20, and 24 h for strains BMB171cry1Ac and BMB171codY-cry1Ac, respectively. Protein extractions were conducted as described by Gong et al. [18]. The bacterial cells were harvested by centrifugation at 10,000 ×g at 4℃ for 5 min. The cells were then resuspended and washed three times with ice-cold PBS. The cells were then suspended in lysis buffer with a protease inhibitor cocktail (Sigma, Missouri, USA) and 1% (w/v) DTT, and then treated by ultrasonication for 10 min. DNase I and RNase A were added to the lysate at a final concentration of 1 mg/ml and 0.25 mg/ml, respectively. The mixture was incubated at 28℃ for 1 h. The cell debris was removed by centrifugation at 12,000 ×g at 4℃ for 20 min. Excess salts were removed from the crude protein samples using the ReadyPrep 2-D cleanup Kit (Bio-Rad Laboratories, Pennsylvania, USA). Protein concentrations were determined by the Bradford method [5].

Purified protein samples were run on isoelectric focusing (IEF) IPG-strip gels (pH 4–7, 17 cm; Bio-Rad). Samples were loaded by active rehydration under an electric field of 50 V for 2 h. First, the IEF was run at 200 V for 1 h. Second, the voltage was increased linearly and maintained at 1,000 V for 1 h. Third, the voltage was raised rapidly and held at 10,000 V for 5 h. Last, the voltage was increased linearly to a maximum of 90,000 V [8,45]. After IEF, the focused strips were placed first in an equilibration solution containing 1% (w/v) dithiothreitol for 15 min, and then in the equilibration solution with 4% (w/v) iodoacetamide for 15 min. The equilibrated strips were placed on 12% SDS-PAGE gels and covered with 0.5% low melting point agarose containing trace amounts of Coomassie bromophenol blue G250. The gels were run in a Bio-Rad Dodeca Cell system at a constant voltage of 80 V for 15 min, and then at 200 V until the marker dye reached the bottom of the gels. After electrophoresis, the gels were stained with silver nitrate [4], scanned with the GS-800 calibrated densitometer (Bio-Rad), and analyzed with the PD Quest software (ver. 8.0; Bio-Rad). Protein profiles with good convergent validity of protein spots, clear background, uniform distribution, and good reproducibility were used for proteomics analysis. Protein samples at each stage were carried out three times in repeated experiments. At least three gels were analyzed for each phase. Proteins were considered differentially expressed when the average values exceeded the thresholds of 2-fold differences and a p-value <0.05.

Protein Identification by MALDI-TOF MS/MS

The differentially expressed protein spots were excised manually from the gels and placed in Eppendorf tubes. Briefly, gel pieces were destained with a solution of 30 mM potassium ferricyanide and 100 mM sodium thiosulfate (1:1 (v/v)) for 20 min at room temperature. The spots were incubated in 0.2 M NH4HCO3 for 20 min and then lyophilized. Each spot was digested overnight in 5 µl (2.5-10 ng/µl) of trypsin (Promega) at 37℃. The peptides were extracted three times with 60% acetonitrile /0.1% trifluoroacetic acid. The extracts were pooled and dried completely in a vacuum centrifuge.

MALD I-TOF MS and MS/MS analyses were performed at Shanghai Applied Protein Technology Co. Ltd. MS and MS/MS data for protein identification were obtained by using the 4800 Plus MALDI TOF/TOF Analyzer (Applied Biosystems). Combined peptide mass fingerprinting and MS/MS queries were performed by using the MASCOT search engine 2.2 (Matrix Science, Ltd.) Search parameters were set as follows: tolerance to 100 ppm peptide mass variance, trypsin cleavage to one missed cleavage allowed, carbamidomethylation set as fixed modification, oxidation of methionine allowed as variable modification, and MS/MS fragment tolerance set to 0.4 Da. A MASCOT confidence interval of 95% was used for further manual validation.

Real-Time PCR Analysis of Differentially Expressed Proteins

The total RNA was isolated with Trizol reagent according to the manufacturer’s instructions (Invitrogen, Grand Island, NY, USA). The RNA samples were treated with RNase-free DNase I (Invitrogen, USA). The quality and quantity were assessed in the UV spectrophotometer DU800 (Beckman Coulter, North RhineWestphalia, USA). Reverse transcription and real-time PCR were performed with the SYBR PrimeScript RT-PCR Kit II (Takara BioRO Inc., Shiga, Japan) following the manufacturer’s instructions.

Primers for real-time PCR were designed with the Primer V5 software (PREMIER Biosoft International, CA, USA) according to the GenBank sequences. We chose the 16S rRNA as the reference gene to normalize expression levels among different samples. All gene-specific primers are listed in Table S2. Quantitative RT-PCR was performed using an ABI ViiA 7 Real-Time PCR System (PE Applied Biosystems, Foster City, CA, USA) using standard procedures (Stage 1: Initial denaturation, 95℃ for 10 min; Stage 2: Amplification, 95℃ for 15 sec, 58℃ for 30 sec, 72℃ for 40 sec, 40 cycles; Melt Curve Stage: 95℃ for 15 sec, 60℃ for 1 min). Negative (no template) controls were included in each PCR run. Each experiment was tested in triplicate. Gene expressions were normalized by 2−∆∆Ct analysis [28].

Bacterial One-Hybrid System and EMSA

Library vector PTRG-codY and reporter vector PBXcmT-gene were constructed and co-transformed into the XL-blue strain [19]. The reporter strains were selected on agar plates containing 15 mM 3-AT (3-amino-1, 2, 4-triazole) and 16 µg/ml streptomycin. Agar plates that did not contain 3-AT and streptomycin were used as controls. Co-transformants containing pBXcmT-Rv2031p and pTRG-Rv3133c were used as positive controls [32].

The purified protein CodY (750 µg/ml), 100-200 bp fragments (100 ng/µl) of target genes, binding buffer (5×), poly L-lysine (0.1 µg/µl), and GTP and BCAAs with the final concentration of 2 mM and 10 mM, respectively, were mixed and incubated at 28℃. After 30 min, the binding reaction mixtures were loaded on a 6.5% native polyacrylamide gel prepared in Tris-glycine buffer.

 

Results and Discussion

We constructed a codY deletion clone from B. thuringiensis strain BMB171 by a gene displacement method. Some physiological changes were observed. This study was conducted to establish a comparative proteomic analysis between different growth phases of BMB171cry1Ac and BMB171codY-cry1Ac. The physiological characterization of the codY mutant, metabolic changes of BCAAs and PHB, translation-related proteins ribosomal recycling factor FRR related to protein synthesis, and late competence protein ComER are discussed below.

Morphological and Physiological Changes of codY Mutant Bacillus thuringiensis Strain

Strain BMB171cry1Ac formed spores and parasporal crystals during the stationary phase, whereas BMB171codY-cry1Ac formed neither spores nor parasporal crystals (Fig. 1A). SDS-PAGE revealed a distinct difference at ~130 kDa (Cry1Ac), where the protein toxin was present for BMB171cry1Ac but not BMB171codY- at entry into the stationary phase (Fig. 1B). The growth of BMB171cry1Ac differed from that of BMB171codY-cry1Ac (Fig. 1C). BMB171cry1Ac and BMB171codY-cry1Ac entered the stationary phase at 10 and 20 h, respectively. The maximum OD600 values of the strains were 10.00 and 14.00. Considering the effect of different morphological characteristics on the refractive index, we used a plate counting dilution method to determine the growth differences between BMB171cry1Ac and BMB171codY-cry1Ac (Fig. S1). The growth trend using the OD600 values and plate counting were similar. PHB accumulation in cells played an important role in cell metabolism [8]. In BMB171cry1Ac, the PHB yield accumulated at the mid-log phase, gradually decreased, and reached its minimum at the late-stationary phase. In contrast, the PHB yield accumulated and remained stable at the stationary phase in BMB171codY-cry1Ac (Fig. 1D). In short, morphological and physiological changes of the codY mutant were observed. CodY influenced genes associated with growth and sporulation. Additionally, PHB accumulation in cells was regulated by CodY in B. thuringiensis.

Fig. 1.Characterization of BMB171cry1Ac and BMB171codY-cry1Ac. (A-1) Transmission electron microscopic observations of BMB171cry1Ac. Bacterial cells were sampled at 30 h. Spore and ICPs are indicated by arrows. (A-2) Transmission electron microscopic observations of BMB171codY-cry1Ac. Bacterial cells were sampled at 30 h. A bright oval spot indicated by an arrow refers to a cross-section of the PHB granules. Scale bars in A-1 and A-2 equal 0.5 µm. (B) SDS-PAGE analysis of BMB171cry1Ac and BMB171codY-cry1Ac proteins. M: Unstained protein molecular weight marker; Lane 1: proteins of BMB171cry1Ac-7 h; Lane 2: proteins of BMB171codY-cry1Ac-12 h; Lane 3: proteins of BMB171cry1Ac-10 h; Lane 4: proteins of BMB171codY-cry1Ac-20 h; Lane 5: proteins of BMB171cry1Ac-22 h; Lane 6: proteins of BMB171codY-cry1Ac-30 h. (C) BMB171cry1Ac and BMB171codY-cry1Ac growth curves. A bar for each sampling time point denotes standard error of the mean from three batches. (D) PHB concentration of BMB171cry1Ac and BMB171codY-cry1Ac at different times. Sampling times and error bars are shown in the figure.

2-DE Analysis, Identification, and Functional Classification of Differentially Accumulating Proteins

We extracted total proteins from BMB171cry1Ac and BMB171codY-cry1Ac at three different stages (mid-log phase, early-stationary phase, and late-stationary phase) and determined protein profiles for each by 2-DE (Fig. 2). Most proteins were within pH 4-7; and the molecular masses were in the range of 10-100 kDa. Forty-three proteins were significantly different in intensity (2-fold or more). Each was identified by MALDI-TOF-MS/MS, revealing 36 matched known proteins (Table S1). The identified proteins were grouped into four classes: metabolism, genetic information processing, environmental information processing, and cellular processes, based on Kyoto Encyclopedia of Genes and Genomes Orthology (KO) protein function annotations. The majority of the identified proteins (75%) were involved in the metabolism category, of which 28% were those involved in carbohydrate metabolism, 21% were involved in amino acid metabolism, and 14% were involved in energy metabolism (Fig. S2). The analysis of a genome-wide identification of CodY binding regions in B. subtilis, S. aureus, C. difficile, and B. anthracis revealed the majority genes were involved in metabolism [2,7,14,29]. These data indicate that CodY regulates proteins involved in metabolic activity.

Fig. 2.Protein profiles of BMB171cry1Ac and BMB171codY-cry1Ac on 2-DE gels. The identified protein spots are labeled and indicated by arrowheads. Protein abbreviations in red color represent up-regulated expression, down-regulated expression is in green, and no change in expression is in black. (A-1) and (A-2) The protein profiles of BMB171cry1Ac-7 h and BMB171codY-cry1Ac-12 h, respectively, sampled the in mid-log phase. (B-1) and (B-2) The protein profiles of BMB171cry1Ac-10 h and BMB171codY-cry1Ac-20 h, respectively, in the early-stationary phase. (C-1) and (C-2) The protein profiles of BMB171cry1Ac-19 h and BMB171codY-cry1Ac-24 h, respectively, in the late-stationary phase. The isoelectric focusing was run in a pH range of 4–7. The protein molecular weight standard is given to the left of the gel images.

Proteomic Analyses of Abundance Changes of Some Proteins

At the three different phases tested between BMB171cry1Ac and BMB171codY-cry1Ac, heat maps of differentially expressed proteins showed expression changes of some proteins involved in the metabolism of BCAAs and PHB, sporulation, growth, genetic competence, and translation (Fig. 3). Real-time quantitative PCR was carried out to verify the differences in transcription. The results were consistent with 2-DE data (Table S3).

Fig. 3.Heat map of differentially expressed proteins. The protein expression levels of BMB171cry1Ac serve as the base for comparison of the protein abundance changes in BMB171codY-cry1Ac. Proteins are grouped into functional categories. Protein quantities in spot volumes were calculated by PD quest V8.0. The protein abundance changes are presented in different colors: red, increasing rates for protein abundances; green: decreasing rates for protein abundances; black: no change in protein expression rates. G I represents samples in mid-log phase; G II represents samples in early-stationary phase; G III represents samples in late-stationary phase. The data for identified proteins are listed in Table S1.

Proteins Involved in Growth

The codY deletion mutant strain, BMB171codY-cry1Ac, could not form spores or parasporal crystals. Additionally, the log phase was extended and the stationary period was delayed (Fig. 1). According to MALDI-TOF-MS analyses and protein expression changes, we found that proteins DivIVA and MreB increased in expression from the early-stationary phase to the late-stationary phase (Fig. 3). DivIVA, a coiled-coil, tropomyosin-like protein, is an important protein in gram-positive bacteria cell division, as it localizes to division sites and is retained at the cell poles after division in B. subtilis [41]. In B. subtilis, divIVA mutant strains are inhibited in cell division initiation [16]. The main cell wall component, peptidoglycan, and the actin-like MreB cytoskeleton are major determinants of cell shape in rod-shaped bacteria [15]. MerB has a high similarity to eukaryotic actin filaments in amino acid sequence, assembly, structure, and function. Furthermore, MreB has a dual role in chromosome segregation and in the formation of rod cell shape in B. subtilis [11]. Increases in the expression of DivIVA and MreB may lead to the delayed log phase and the increase of biomass.

Proteins Involved in PHB Metabolism

PHB provides energy and a carbon source for bacterial reproduction or stress tolerance [40]. In our study, the PHB yield in BMB171codY-cry1Ac continuously accumulated and remained in the cell at the stationary phase, whereas in BMB171cry1Ac, the PHB yield accumulated and remained stable at the stationary phase (Fig. 1D). Previous studies revealed that the energy for synthesis of parasporal crystals originates from PHB hydrolysis in B. thuringiensis [18]. Two proteins, 3-hydroxybutyryl-CoA dehydratase Crt and 4-aminobutyrate aminotransferase GabT, important enzymes in PHB biosynthesis, were up-regulated at all three stages in the codY mutant strain (Fig. 3). Crt participates in butanoate metabolism and can catalyze acetoacetyl-CoA to 3-hydroxybutanoyl-CoA. Synthesis of PHB from 3-hydroxybutanoyl-CoA is catalyzed by the poly(R)-hydroxyalkanoic acid synthase subunit PhaC. GabT, which participates in gamma-aminobutyric acid metabolism, catalyzes aminobutanoate to succinate semialdehyde, which may promote the synthesis of crotonoyl CoA as the precursor of PHB (Fig. 4). PHB begins to accumulate during the exponential phase, and is utilized in the stationary phase in B. thuringiensis as a carbon and energy storage material [9]. Proteins involved in the PHB degradation pathway have not yet been identified in our study. A PHB granule is surrounded by a layer of phospholipids and proteins, with phasins (PhaP) as the predominant compound [13]. Overexpression of PhaP results in the formation of many small granules in cells [33]. In contrast, a deletion of the phaP gene results in the formation of only one or two large granules [44]. Decreased expression of PhaP in the mutant strain led to a small number, but larger PHB granules.

Fig. 4.PHB metabolism regulated by CodY. (A) The major PHB metabolic pathways. Enzyme names in red denote increased abundances of the corresponding proteins, in green color are decreased abundances, and in black color are no change in protein expressions. The intermediate products are in green color. (B) Model of PHB granules. PhaP is the predominant compound of the surface layer of PHB granules.

Proteins Involved in Sporulation

Previous studies revealed that CodY regulates several genes (spo0A, rapA, rapE, citB) involved in sporulation in B. subtilis [30,35]. Spo0A, which is activated by phosphorylation, is an important response regulator protein in the initiation of sporulation of bacteria [6,24]. CitB (aconitase), a factor required for efficient late-sporulation gene expression in B. subtilis, may regulate GerE, which is responsible for the efficient timing of spore coat assembly [34]. The spore coat-associated protein, CotN, was decreased in all of the three phases, providing evidence for the sporulation deficiency observed in our mutants (Fig. 3). Deletion of the phaC gene from the BMB171 strain results in a sporulation-deficient phenotype [8]. The continuous accumulation of PHB in BMB171codY-cry1Ac may result from uncontrolled gene expression or suppression of PHB degradation pathways.

Proteins Related to BCAAs Metabolism

BCAAs are effectors of CodY. We identified by MALDI-TOF-MS 13 proteins associated with BCAAs metabolism. IlvB, IlvC, IlvE, and LeuB, which are important enzymes in the biosynthesis of BCAAs, were up-regulated at all of the three stages in the codY mutant strain (Fig. 3). Acyl-CoA dehydrogenase (ACD), dihydrolipoamide dehydrogenase (PdhD), and hydroxymethylglutaryl-CoA lyase (HmgL) participate in the degradation of BCAAs (KEGG Orthology protein function annotations). ACD, PdhD, and HmgL were down-regulated in each of the three phases (Fig. 3). These results suggest that CodY can regulate BCAAs metabolism. Enzymes involved in the biosynthesis of BCAAs were up-regulated, whereas those involved in BCAAs degradation were down-regulated (Fig. 5). B. subtilis has four transcription units devoted to BCAAs biosynthesis. All but ilvA are repressed by CodY [37-39]. Bacterial one-hybrid experiments and EMSA confirmed CodY directly regulates the promoters of the ilv operon in B. thuringiensis (Fig. 6). These data are consistent with the results in B. subtilis [37-39].

Fig. 5.BCAAs metabolism regulated by CodY. The diagram shows the major BCAAs metabolic pathways, including biosynthesis and degradation. Enzyme names in red denote increased abundances of the corresponding proteins, in green color are decreased abundances, and in black color are no change in protein expressions. The amino acid names are in gray color with yellow shading and the intermediate products are in green color.

Fig. 6.Bacterial one-hybrid assays and EMSA for the binding of CodY with the target genes. (A) Bacterial one-hybrid assays tested for interactions of CodY with the target genes. The triangle indicates 3-fold titration steps of input and sample template. (B) EMSA for the binding of CodY with the target genes. The triangle indicates the rising concentrations of CodY. In each panel, the position of unshifted DNA is seen in the leftmost lane, which contained no CodY.

Ribosomal Recycling Factor FRR

Protein synthesis occurs in three steps: initiation, elongation, and termination. A fourth step involves the disassembly of the post-termination complex [22,46]. Ribosomal recycling factor FRR and elongation factor EF-G split the ribosome into subunits by a mechanism requiring GTP and GTP hydrolysis [22,47]. However, the other activities of FRR and EF-G during ribosome recycling are still controversial [21]. FRR is a multifunctional protein in prokaryotes and plays an indispensable role in synthesis of proteins [47]. In a lack of FRR, ribosomes can recognize the mRNA termination codon, but termination does not occur; another translation initiation occurs from downstream initiation codons. In the overexpressing CodY strain YBT-881-L1, FRR is down-regulated in all of the three phases (unpublished data). FRR was up-regulated in all of the three stages in codY mutant strain BMB171codY-cry1Ac. CodY may directly regulate the promoter region of frr (Fig. 6). The relationship between CodY regulation and FRR has not been reported for other gram-positive bacteria.

Late Competence Protein ComER

Late competence protein ComER is reported to be associated with genetic competence in bacteria, and comER belongs to a member of late “com” genes. comE has been studied extensively in Streptococcus pneumonia [10,43]. ComDE proteins are members of the two-component system of sensor regulators, which are essential for the signaling cascade that could lead to the development of processes responsible for genetic transformation [10]. CodY may directly regulate comk, another member of late “com” genes, in B. subtilis [36]. comk, which encodes a master regulator of genetic competence, directs late competence gene transcription [31]. In BMB171, the comE operon includes four genes, comEC, comEA, comEB, and comER. comER is arranged in the reverse orientatian on the bacterial chromosome. Our bacterial one-hybrid and EMSA experiments verified a conserved 10 bp CodY binding site, TTTCAGAAAA, within comEA (Fig. 6). These data suggest that CodY may directly regulate “com” genes in B. thuringiensis. Unexpectedly, the expression of ComER remained unchanged in both the log and early-stationary phases and was down-regulated in the late-stationary phase (Fig. 3).

In conclusion, we conducted a functional study of the global regulator CodY in B. thuringiensis. CodY regulates many genes involved in microbial metabolism, such as amino acid metabolism, carbohydrate metabolism, fatty acid metabolism, and energy metabolism. Furthermore, CodY regulates genes involved in growth, late competence protein ComER, and BCAAs metabolism in B. thuringiensis. In addition, CodY appears to regulate ribosomal recycling factor FRR, which has not been reported for other gram-positive bacteria. Finally, CodY appears to regulate and influence the formation of spores and parasporal crystals in B. thuringiensis.

References

  1. Arantes O, Lereclus D. 1991. Construction of cloning vectors for Bacillus thuringiensis. Gene 108: 115-119. https://doi.org/10.1016/0378-1119(91)90495-W
  2. Belitsky BR, Sonenshein AL. 2013. Genome-wide identification of Bacillus subtilis CodY binding sites at single nucleotide resolution. Proc. Natl. Acad. Sci. USA 110: 7026-7031. https://doi.org/10.1073/pnas.1300428110
  3. Bergara F, Ibarra C, Iwamasa J, Patarroyo JC, Aguilera R, Marquez-Magan LM. 2003. CodY is a nutritional repressor of flagellar gene expression in Bacillus subtilis. J. Bacteriol. 185: 3118-3126. https://doi.org/10.1128/JB.185.10.3118-3126.2003
  4. Blum H, Beier H, Gross H. 1987. Improved silver staining of plant proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8: 93-99. https://doi.org/10.1002/elps.1150080203
  5. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254. https://doi.org/10.1016/0003-2697(76)90527-3
  6. Burbulys D, Trach KA, Hoch JA. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 6: 545-552. https://doi.org/10.1016/0092-8674(91)90238-T
  7. Chateau A, van Schaik W, Joseph P, Handke LD, McBride SM, Smeets FM, et al. 2013. Identification of CodY targets in Bacillus anthracis by genome-wide in vitro binding analysis. J. Bacteriol. 195: 1204-1213. https://doi.org/10.1128/JB.02041-12
  8. Chen D, Xu D, Li M, He J, Gong Y, Wu D, Sun M, Yu Z. 2012. Proteomic analysis of Bacillus thuringiensis $\Delta$phaC mutant BMB171/PHB$^{-1}$ reveals that the PHB synthetic pathway warrants normal carbon metabolism. Proteomics 75: 5176-5188. https://doi.org/10.1016/j.jprot.2012.06.002
  9. Chen HJ, Tsai TK, Pan SC, Lin JS, Tseng CL, Shaw GC. 2010. The master transcription factor Spo0A is required for poly (3-hydroxybutyrate) (PHB) accumulation and expression of genes involved in PHB biosynthesis in Bacillus thuringiensis. FEMS Microbiol. Lett. 304: 74-81. https://doi.org/10.1111/j.1574-6968.2009.01888.x
  10. Cheng Q, Campbell EA, Naughton AM, Johnson S, Masure HR. 1997. The com locus controls genetic transformation in Streptococcus pneumonia. Mol. Microbiol. 23: 683-692. https://doi.org/10.1046/j.1365-2958.1997.2481617.x
  11. Defeu Soufo HJ, Graumann PL. 2005. Bacillus subtilis actin-like protein MreB influences the positioning of the replication machinery and requires membrane proteins MreC/D and other actin-like proteins for proper localization. BMC Cell Biol. 6: 10. https://doi.org/10.1186/1471-2121-6-10
  12. Den Hengst CD, van Hijum SA, Geurts JM, Nauta A, Kok J, Kuipers OP. 2005. The Lactococcus lactis CodY regulon: identification of a conserved cis-regulatory element. J. Biol. Chem. 280: 34332-34342. https://doi.org/10.1074/jbc.M502349200
  13. Dennis D, Sein V, Martinez E, Augustine B. 2008. PhaP is involved in the formation of a network on the surface of polyhydroxyalkanoate inclusions in Cupriavidus necator H16. J. Bacteriol. 190: 555-563. https://doi.org/10.1128/JB.01668-07
  14. Dineen SS, McBride SM, Sonenshein AL. 2010. Integration of metabolism and virulence by Clostridium difficile CodY. J. Bacteriol. 192: 5350-5362. https://doi.org/10.1128/JB.00341-10
  15. Dominguez-Escobar J, Chastanet A, Crevenna AH, Fromion V, Wedlich-Soldner R, Carballido-Lopez R. 2011. Processive movement of MreB-associated cell wall biosynthetic complexes in bacteria. Science 333: 225-228. https://doi.org/10.1126/science.1203466
  16. Edwards DH, Errington J. 1997. The Bacillus subtilis DivIVA protein targets to the division septum and controls the site specificity of cell division. Mol. Microbiol. 24: 905-915. https://doi.org/10.1046/j.1365-2958.1997.3811764.x
  17. Fenner C, Traut RR, Mason DT, Wikman-Coffelt J. 1975. Quantification of Coomassie Blue stained proteins in polyacrylamide gels based on analyses of eluted dye. Anal. Biochem. 6: 595-602. https://doi.org/10.1016/0003-2697(75)90386-3
  18. Gong Y, Li M, Xu D, Wang H, He J, Wu D, et al. 2012. Comparative proteomic analysis revealed metabolic changes and the translational regulation of Cry protein synthesis in Bacillus thuringiensis. Proteomics 75: 1235-1246. https://doi.org/10.1016/j.jprot.2011.10.037
  19. Guo M, Feng H, Zhang J, Wang W, Wang Y, Li Y, et al. 2009. Dissecting transcription regulatory pathways through a new bacterial one-hybrid reporter system. Genome Res. 19: 1301-1308. https://doi.org/10.1101/gr.086595.108
  20. Handke LD, Shivers RP, Sonenshein AL. 2008. Interaction of Bacillus subtilis CodY with GTP. J. Bacteriol. 190: 798-806. https://doi.org/10.1128/JB.01115-07
  21. Hirokawa G, Demeshkina N, Iwakura N, Kaji H, Kaji A. 2006. The ribosome recycling step: consensus or controversy? Trends Biochem. Sci. 31: 143-149. https://doi.org/10.1016/j.tibs.2006.01.007
  22. Hirokawa G, Kiel MC, Muto A, Selmer M, Raj VS, Liljas A, et al. 2002. Post-termination complex disassembly by ribosome recycling factor, a functional tRNA mimic. EMBO J. 21: 2272-2281. https://doi.org/10.1093/emboj/21.9.2272
  23. Hsueh YH, Somers EB, Wong AC. 2008. Characterization of the cody gene and its influence on biofilm formation in Bacillus cereus. Arch. Microbiol. 189: 557-568. https://doi.org/10.1007/s00203-008-0348-8
  24. Jiang M, Grau R, Perego M. 2000. Differential processing of propeptide inhibitors of Rap phosphatases in Bacillus subtilis. J. Bacteriol. 182: 303-310. https://doi.org/10.1128/JB.182.2.303-310.2000
  25. Law JH, Slepecky RA. 1961. Assay of poly-beta-hydroxybutyric acid. J. Bacteriol. 82: 33-36.
  26. Levdikov VM, Blagova E, Joseph P, Sonenshein AL, Wilkinson AJ. 2006. The structure of CodY, a GTP and isoleucine-responsive regulator of stationary phase and virulence in gram-positive bacteria. J. Biol. Chem. 281: 11366-11373. https://doi.org/10.1074/jbc.M513015200
  27. Li L, Yu ZN. 1999. The transform and expressed property of Bacillus thuringiensis non-plasmid mutant strain BMB171. Chin. J. Appl. Environ. Microbiol. 5: 395-399.
  28. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2$^{{\Delta}{\Delta}Ct}$ method. Methods 25: 402-408. https://doi.org/10.1006/meth.2001.1262
  29. Majerczyk CD, Dunman PM, Luong TT, Lee CY, Sadykov MR, Somerville GA, et al. 2010. Direct targets of CodY in Staphylococcus aureus. J. Bacteriol. 192: 2861-2877. https://doi.org/10.1128/JB.00220-10
  30. Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL. 2003. Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immuno-precipitation and genome-wide transcript analysis. J. Bacteriol. 185: 1911-1922. https://doi.org/10.1128/JB.185.6.1911-1922.2003
  31. Ogura M, Tanaka T. 2009. The Bacillus subtilis late competence operon comE is transcriptionally regulated by yutB and under post-transcription initiation. J. Bacteriol. 191: 949-958. https://doi.org/10.1128/JB.01429-08
  32. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, et al. 2003. Rv333c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis. Mol. Microbiol. 48: 833-843. https://doi.org/10.1046/j.1365-2958.2003.03474.x
  33. Potter M, Madkour MH, Mayer F, Steinbuchel A. 2002. Regulation of phasin expression and polyhydroxyalkanoate (PHA) granule formation in Ralstonia eutropha H16. Microbiology 148: 2413-2426. https://doi.org/10.1099/00221287-148-8-2413
  34. Ratcliff WC, Kadam SV, Denison RF. 2008. Poly-3-hydroxybutyrate (PHB) supports survival and reproduction in starving rhizobia. FEMS Microbiol. Ecol. 65: 391-399. https://doi.org/10.1111/j.1574-6941.2008.00544.x
  35. Ratnayake-Lecamwasam M, Serror P, Wong KW, Sonenshein AL. 2001. Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes Dev. 15: 1093-1103. https://doi.org/10.1101/gad.874201
  36. Serror P, Sonenshein AL. 1996. CodY is required for nutritional repression of Bacillus subtilis genetic competence. J. Bacteriol. 178: 5910-5915. https://doi.org/10.1128/jb.178.20.5910-5915.1996
  37. Shivers RP, Sonenshein AL. 2004. Activation of the Bacillus subtilis global regulator CodY by direct interaction with branched-chain amino acids. Mol. Microbiol. 53: 599-611. https://doi.org/10.1111/j.1365-2958.2004.04135.x
  38. Sonenshein AL. 2005. CodY, a global regulator of stationary phase and virulence in gram-positive bacteria. Curr. Opin. Microbiol. 8: 203-207. https://doi.org/10.1016/j.mib.2005.01.001
  39. Sonenshein AL. 2007. Control of key metabolic intersections in Bacillus subtilis. Nat. Rev. Microbiol. 5: 917-927. https://doi.org/10.1038/nrmicro1772
  40. Sonenshein AL. 2000. Control of sporulation initiation in Bacillus subtilis. Curr. Opin. Microbiol. 3: 561-566. https://doi.org/10.1016/S1369-5274(00)00141-7
  41. Thomaides HB, Freeman ME, Karoui M, Errington J. 2001. Division site selection protein DivIVA of Bacillus subtilis has a second distinct function in chromosome segregation during sporulation. Genes Dev. 15: 1662-1673. https://doi.org/10.1101/gad.197501
  42. Villapakkam AC, Handke LD, Belitsky BR, Levdikov VM, Wilkinson AJ, Sonenshein. AL. 2009. Genetic and biochemical analysis of the interaction of Bacillus subtilis CodY with branched-chain amino acids. J. Bacteriol. 191: 6865-6876. https://doi.org/10.1128/JB.00818-09
  43. Ween O, Gaustad P, Havarstein LS. 1999. Identification of DNA binding sites for ComE, a key regulator of natural competence in Streptococcus pneumonia. Mol. Microbiol. 33: 817-827. https://doi.org/10.1046/j.1365-2958.1999.01528.x
  44. Wieczorek R, Pries A, Steinbuchel A, Mayer F. 1995. Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus. J. Bacteriol. 177: 2425-2435. https://doi.org/10.1128/jb.177.9.2425-2435.1995
  45. Wu D, He J, Gong Y, Chen D, Zhu X, Qiu N, et al. 2011. Proteomic analysis reveals the strategies of Bacillus thuringiensis YBT-1520 for survival under long-term heat stress. Proteomics 11: 2580-2591. https://doi.org/10.1002/pmic.201000392
  46. Yokoyama T, Shaikh TR, Iwakura N, Kaji H, Kaji A, Agrawal RK. 2012. Structural insights into initial and intermediate steps of the ribosome-recycling process. EMBO J. 31: 1836-1846. https://doi.org/10.1038/emboj.2012.22
  47. Zavialov AV, Hauryliuk VV, Ehrenberg M. 2005. Splitting of the post-termination ribosome into subunits by the concerted action of RRF and EF-G. Mol. Cell 18: 675-686. https://doi.org/10.1016/j.molcel.2005.05.016

Cited by

  1. Functional analysis of the sporulation-specific diadenylate cyclase CdaS in Bacillus thuringiensis vol.6, pp.None, 2015, https://doi.org/10.3389/fmicb.2015.00908
  2. Poly-β-hydroxybutyrate Metabolism Is Unrelated to the Sporulation and Parasporal Crystal Protein Formation in Bacillus thuringiensis vol.7, pp.None, 2015, https://doi.org/10.3389/fmicb.2016.00836
  3. CodY-Dependent Regulation of Sporulation in Clostridium difficile vol.198, pp.15, 2016, https://doi.org/10.1128/jb.00220-16
  4. CodY Promotes Sporulation and Enterotoxin Production by Clostridium perfringens Type A Strain SM101 vol.85, pp.3, 2017, https://doi.org/10.1128/iai.00855-16
  5. c-di-GMP Regulates Various Phenotypes and Insecticidal Activity of Gram-Positive Bacillus thuringiensis vol.9, pp.None, 2015, https://doi.org/10.3389/fmicb.2018.00045
  6. Branching Out: Alterations in Bacterial Physiology and Virulence Due to Branched-Chain Amino Acid Deprivation vol.9, pp.5, 2015, https://doi.org/10.1128/mbio.01188-18