• Korean Journal of Plant Taxonomy
• /
• v.41 no.2
• /
• pp.130-137
• /
• 2011

Pedicularis growing at Mt. Halla of Jeju Island is known as an endemic species of P. hallaisanensis Hurusawa. On the other hand, the plant is morphologically similar to P. amoena, P. spicata, and P. verticillata in gross morphology, so the taxonomic treatment of the taxon remains controversial. To clarify the taxonomic position of the plants, we examined external morphological characters and nuclear ribosomal DNA ITS sequences for P. hallaisanensis and its related species. The plants of Mt. Halla are clearly different from P. amoena and P. verticillata in the morphology of calyx lobes, the length of galea and lower lip, density of glandular hairs on plants, presences of the radical leaves after anthesis and molecular data. However, P. hallaisanensis is not clearly separated from P. spicata distributed in N. E. Asia on external morphological characters and DNA sequences of internal transcribed spacers. In this study, the morphological and molecular data suggested that P. hallaisanensis should be merged into the former species.

• The Korea Journal of Herbology
• /
• v.29 no.6
• /
• pp.45-53
• /
• 2014

Objectives : Due to the morphological similarity of in the roots of herbal medicine, the official herbal medicine is very difficult to authenticate between the original plants of Patriniae Radix and two adulterant Patrinia species. Therefore, we introduced DNA barcode analysis to establish a powerful tool for the authentication of Patriniae Radix from its adulterants. Methods : To analyze DNA barcode regions, genomic DNA was extracted from twenty-nine specimens of Patrinia scabiosaefolia, Patrinia villosa, Patrinia saniculifolia, and Patrinia rupestris, and internal transcribed spacer 2(ITS2), matK and rbcL genes were amplified. For identification of species specific sequences, a comparative analysis was performed by the ClastalW based on entire sequences of ITS2, matK and rbcL genes, respectively. Results : In comparison of three DNA barcode sequences, we identified 22, 22, and 12 species-specific nucleotides enough to distinguish each four species from ITS2, matK and rbcL gene, respectively. The sequence differences at the corresponding positions were available genetic marker nucleotides to discriminate the correct species among analyzed four species. These results indicated that comparative analysis of ITS2, matK and rbcL genes were useful genetic markers to authenticate Patriniae Radix. Conclusions : The marker nucleotides enough to distinguish P. scabiosaefolia, P. villosa, P. saniculifolia, and P. rupestris, were obtained at 22 SNP marker nucleotides from ITS2 and matK DNA barcode sequences, but they were confirmed at 12 SNP marker nucleotides from rbcL. These differences could be used to authenticate Patriniae Radix from its adulterants as well as discriminating each four species.

• Journal of Mushroom
• /
• v.10 no.2
• /
• pp.93-99
• /
• 2012

This study was carried to identify a correct species and asses genetic diversity within the same species of Grifola spp. preserved in Division of applied Microbiology. Contaminated isolates showed different growth rates, morphology and color of hyphae. We have reconstructed the phylogenetic tree of a select group of Grifola spp. using nucleotide sequences of the internal transcribed spacer region(ITS) region. The phylogenetic tree was constructed by using the neighbor-joining method. PELF primers of 20-mer were used to assess genetic diversity of preserved isolates. Sequence analysis showed that four strains were identified completely different nomenclature. According to the analysis of ITS sequences, the genus Grifola clustered into one group, most of which correlated with species-groups identified by RAPD method. Eight isolates included strain GM01 showed high similarity with Grifola frondosa. All isolates were collected in the Japan(GM01, GM02, GM03) was identified as Grifola frondosa and isolates of the China(GM05, GM06, GM08) was identified as Bjerkandera fumosa, Grifola frondosa and Dichomitus squalens, respectively. RAPD analysis of genetic polymorphisms of genus Grifola showed a very different band patterns on the isolat. As the result of RAPD and ITS region sequences analysis for preserved isolates, it seems likely that 4 isolates of Grifola spp. may be need to reclassify or eliminate from preserved catalogue.

• Journal of Mushroom
• /
• v.9 no.1
• /
• pp.27-33
• /
• 2011

This study was carried to identify a correct species and asses genetic diversity within the same species of Trametes spp. preserved in Division of applied Microbiology The morphological and cultural characteristics of preserved strains were observed through microscope and investigated on PDA, respectively. Contaminated isolates showed different growth rates, morphology and color of hyphae. We have reconstructed the phylogenetic tree of a select group of Trametes spp. using nucleotide sequences of the internal transcribed spacer region(ITS) region. The phylogenetic tree was constructed by using the neighbor-joining method. PELF primers of 20-mer were used to assess genetic diversity of preserved isolates. Sequence analysis showed that five strains were different species and six strains were identified completely different nomenclature. According to the analysis of ITS sequences, the genus Trametes clustered into four distinct group, most of which correlated with species-groups identified by RAPD method. Seven isolates included TM 01 strain showed high similarity with Trametes versicolr, TM 07 and TM 10 high similarity with Trametes gibbosa, and TM 05 high similarity with Trametes elegans. But isolates collected in the United States was identified as T. junipericola. T. gibbosa and T. versicolor by RAPD analysis of genetic polymorphisms showed a very different band patterns and these strains showed different band patterns on areas. As the result of RAPD and ITS region sequences analysis for preserved isolates, it seems likely that 11 isolates of Trametes spp. may be need to reclassify or eliminate from preserved catalogue.

• Journal of Mushroom
• /
• v.10 no.1
• /
• pp.37-43
• /
• 2012

This study was carried to identify a correct species and asses genetic diversity within the same species of Polyporus spp. preserved in Division of applied Microbiology. Contaminated isolates showed different growth rates, morphology and color of hyphae. We have reconstructed the phylogenetic tree of a select group of Polyporus spp. using nucleotide sequences of the internal transcribed spacer region(ITS) region. The phylogenetic tree was constructed by using the neighbor-joining method. PELF primers of 20-mer were used to assess genetic diversity of preserved isolates. Sequence analysis showed that three strains were different species and four strains were identified completely different nomenclature. According to the analysis of ITS sequences, the genus Polyporus clustered into five distinct group, most of which correlated with species-groups identified by RAPD method. Four isolates included strain PM02 showed high similarity with P. arcularius, four isolates included strain PM03 high similarity with P. alveolaris, three isolates included strain PM01 high similarity with P. tuberaster, and PM 06 and PM04 high similarity with P. brumalis and P. squamossus. Isolates were collected in the United States(PM10, PM11) was identified as P. alveolarius and P. arcularius. RAPD analysis of genetic polymorphisms of genus Polyporus showed a very different band patterns. As the result of RAPD and ITS region sequences analysis for preserved isolates, it seems likely that 6 isolates of Polyporus spp. may be need to reclassify or eliminate from preserved catalogue.

• Journal of Ginseng Research
• /
• v.41 no.3
• /
• pp.339-346
• /
• 2017

Background: In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. Methods: HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Results: Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. Conclusion: P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical basis for the development of a quality traceability system of traditional Chinese medicine based on a two-dimensional code.

• Research in Plant Disease
• /
• v.11 no.1
• /
• pp.56-65
• /
• 2005

To establish taxonomic system of morphologically similar species of small-spored Alternaria, phylogenetic analysis of internal transcribed spacer (ITS 1, ITS 2 and 5.8S rDNA) and mitochondrial small subunit (mt SSU) rDNA sequences and URP-PCR fingerprinting analysis from 11 species ofAlternaria were performed. Phylogenetic analysis of ITS and mt SSU rDNA sequences revealed that 10 out of 11 species of the smallspored Alternaria were phylogenetically identical with a bootstrap value of 100%. A. infectoria only was phylogenetically differentiated from the other species. The results suggest that the 10 small-spored Alternaria species are very closely related evolutionally and the markers can not be used for differentiation of the smallspored Alternaria species. URP-PCR fingerprinting analysis from eleven species of smallspored Alternaria using 10 URP primers showed that it was possible to differentiate the species, although genetic similarities were found among the species. The Alternaria sp. from common pokeweed could be distinguished from other species by URP-PCR analysis, and it was considered as a new species. A. infectoria could be easily distinguished from the other 10 species by phylogenetic analysis of ITS and mt SSU rDNA sequences and the URPPCR fingerprinting analysis.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• The Korean Journal of Mycology
• /
• v.45 no.3
• /
• pp.224-228
• /
• 2017

The fungal strain, designated KNU16-008, was isolated from field soil in Chungcheongnam-do, Korea. The isolated fungi was characterized by morphological and phylogenetic analyses. Isolated fungus showed typical morphological characteristics of the genus Sporothrix. Based on its phylogenic analysis using internal transcribed spacer (ITS) of rDNA and ${\beta}$-tubulin gene sequences, the strain KNU16-008 was identified as Sporothrix stylites. This species has not been previously reported in Korea.

• Fisheries and Aquatic Sciences
• /
• v.11 no.1
• /
• pp.32-35
• /
• 2008

The Suminoe oyster, Crassostrea ariakensis, occurs in estuaries where rivers meet seawater. In Korea, it is one of the most popular fisheries resources in the Nam River and Sumjin River. However, the genetic identification of this species has been questioned, because specimens are often mis-identified as other species. To identify the species, we conducted polymerase chain reaction (PCR) amplification of the internal transcribed spacer-1 (ITS-1) region, followed by digestion with the restriction enzyme HaeIII. Restriction profiles for oysters collected from Korea, Japan, and China (north and south) were determined by comparing the PCR-restriction fragment length polymorphism (RFLP) patterns of the ITS-1 regions. Our study verified that the oysters collected from Korea were C. ariakensis based on the PCR-RFLP patterns. These results emphasize the value of molecular markers for identifying morphologically uncertain species.