• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Journal of Plant Biotechnology
• /
• 제45권4호
• /
• pp.322-327
• /
• 2018

Post-translational modification of proteins regulates signaling cascades in eukaryotic system, including plants. Among these modifications, phosphorylation plays an important role in modulating the functional properties of proteins. Plants perceive environmental cues that directly affect the phosphorylation status of many target proteins. To determine the effect of environmentally induced phosphorylation in plants, in vivo methods must be developed. Various in vitro methods are available but, unlike in animals, there is no optimized methodology for detecting protein phosphorylation in planta. Therefore, in this study, a robust, and easy to handle Phos-Tag Mobility Shift Assay (PTMSA) is developed for the in vivo detection of protein phosphorylation in plants by empirical optimization of methods previously developed for animals. Initially, the detection of the phosphorylation status of target proteins using protocols directly adapted from animals failed. Therefore, we optimized the steps in the protocol, from protein migration to the transfer of proteins to PVDF membrane. Supplementing the electrophoresis running buffer with 5mM $NaHSO_3$ solved most of the problems in protein migration and transfer. The optimization of a fast and robust protocol that efficiently detects the phosphorylation status of plant proteins was successful. This protocol will be a valuable tool for plant scientists interested in the study of protein phosphorylation.

• Journal of Microbiology and Biotechnology
• /
• 제27권3호
• /
• pp.624-632
• /
• 2017

Penicillium expansum causes blue mold rot, a prevalent postharvest disease of pome fruit, and is also the main producer of the patulin. However, knowledge on the molecular mechanisms involved in this pathogen-host interaction remains largely unknown. In this work, a two-dimensional gel electrophoresis-based proteomic approach was applied to probe changes in P. expansum 3.3703 cultivated in apple juice medium, which was used to mimic the in planta condition. The results showed that the pH value and reducing sugar content in the apple juice medium decreased whereas the patulin content increased with the growing of P. expansum. A total of 28 protein spots that were up-regulated in P. expansum when grown in apple juice medium were identified. Functional categorization revealed that the identified proteins were mainly related to carbohydrate metabolism, secondary metabolism, protein biosynthesis or degradation, and redox homeostasis. Remarkably, several induced proteins, including glucose dehydrogenase, galactose oxidase, and FAD-binding monooxygenase, which might be responsible for the observed medium acidification and patulin production, were also detected. Overall, the experimental results provide a comprehensive interpretation of the physiological and proteomic responses of P. expansum to the host plant environment, and future functional characterization of the identified proteins will deepen our understanding of fungi-host interactions.

• Molecules and Cells
• /
• 제25권3호
• /
• pp.368-375
• /
• 2008

Approximately 120 UDP-glycosyltransferases (UGTs), which are classified into 14 distinct groups (A to N), have been annotated in the Arabidopsis genome. UGTs catalyze the transfer of sugars to various acceptor molecules including flavonoids. Previously, UGT71C1 was shown to glycosylate the 3-OH of hydroxycinnamates and flavonoids in vitro. Such secondary metabolites are known to play important roles in plant growth and development. To help define the role of UGT71C1 in planta, we investigated its expression patterns, and isolated and characterized a loss-of-function mutation in the UGT71C1 gene (named ugt71c1-1). Our analyses by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR), microarray data mining, and histochemical detection of GUS activity driven by the UGT71C1 promoter region, revealed the tissue-specific expression patterns of UGT71C1 with highest expression in roots. Interestingly, upon treatment with methyl viologen (MV, paraquat), ugt71c1-1 plants displayed enhanced resistance to oxidative stress, and ROS scavenging activity was higher than normal. Metabolite profiling revealed that the levels of two major glycosides of quercetin and kaempferol were reduced in ugt71c1-1 plants. In addition, when exposed to MV-induced oxidative stress, eight representative ROS response genes were expressed at lower levels in ugt71c1-1 plants, indicating that ugt71c1-1 probably has higher non-enzymatic antioxidant activity. Taken together, our results indicate that ugt71c1-1 has increased resistance to oxidative stress, suggesting that UGT71C1 plays a role in some glycosylation pathways affecting secondary metabolites such as flavonoids in response to oxidative stress.