토양에서 분리한 알칼리 내성 Bacillus속의 chromosomal DNA로부터 promoter를 cloning하여 선별된 재조합 plasmid p-12내 의 promoter를 subcloning을 하였다. 그 결과 cloning된 promoter 내에는 서로 다른 두 가지의 promoter가 존재하는 것을 확인할 수 있었고 이로부터 각각의 promoter를 함유한 재조합 plasmid p-l2B1, p-l2B2를 제조하였다. 또한 CAT 비활성 측정에 의해 각 promoter의 활성을 비교해 본 결과 p-l2B1의 promoter는 p-l2B2의 promoter에 비해 상대적으로 높은 활성을 가지고 있었다. CAT 비활성을 생육시기에 따라 측정해 본 결과 p-l2B1과 p-l2B2는 대수증식기 이후 활성이 급증되었으며 배지 중 첨가된 1.0%의 glucose에 의해 활성이 억제되는 효과를 받았다.
GTP cyclohydrolase I (GTPCH) is a key enzyme in the de novo synthesis of tetrahydrobiopterin. Previously, the Drosophila melanogaster GTPCH gene has been shown to be expressed from two different promoters (P1 and P2). In our study, the 5'-flanking DNA regions required for P1 and P2 promoter activities were characterized using transient expression assay. The DNA regions between -98 and +31, and between -73 and +35 are required for efficient P1 and P2 promoter activities, respectively. The regions between -98 and -56 and between -73 and -41 may contain critical elements required for the expression of GTPCH in Drosophila. By aligning the nucleotide sequences in the P1 and P2 promoter regions of the Drosophila melanogaster and Drosophila virilrs GTPCH genes, several conserved elements including palindromic sequences in the regions critical for P1 and P2 promoter activities were identified. Western blot analysis of transgenic flies transformed using P1 or P2 promoter-lacZ fusion plasmids further revealed that P1 promoter expression is restricted to the late pupae and adult developmental stages but that the P2 promoter driven expression of GTPCH is constitutive throughout fly development. In addition, X-gal staining of the embryos and imaginal discs of transgenic flies suggests that the P2 promoter is active from stage 13 of embryo and is generally active in most regions of the imaginal discs at the larval stages.
본 연구에서는 lignocellulosic biomass (xylose)의 부가가치를 높이고 효율적인 활용을 위해 xylitol dehydrogenase를 Saccharomyces cerevisiae 숙주세포에서 분비 생산하고자 하였다. 먼저 S. cerevisiae와 Pichia stipitis유래 XYL2 유전자(S.XYL2 and P.XYL2 gene)의 발현 시스템을 구축하기 위하여 GAL10 promoter와 ADH1 promoter 하류에 각각 mating factor ${\alpha}$ ($MF{\alpha}$) signal sequence와 XYL2유전자를 가진 $pGMF{\alpha}-S.XYL2$, $pGMF{\alpha}-P.XYL2$, $pAMF{\alpha}-S.XYL2$와 $pAMF{\alpha}-P.XYL2$ plasmid를 구축하였다. 각각의 plasmid는 S. cerevisiae $SEY2102{\Delta}trp1$ 균주에 형질전환되었고, 생산된 xylitol dehydrogenase의 활성을 조사해 본 결과, GAL10 promoter가 ADH1 promoter보다 XYL2유전자의 발현에 더욱 적합함을 확인 할 수 있었다. 또한 P. stipitis 유래의 xylitol dehydrogenase 효소 활성이 S. cerevisiae 유래의 효소 활성보다 2배 이상 더 높았으며, 활성의 증가를 위해 두 유전자 모두 cofactor로 $NAD^+$에 의존한다는 것을 확인하였다. 재조합 유전자가 가지는 분비서열에 의해 $SEY2102{\Delta}trp1/pGMF{\alpha}-P.XYL2$ 균주에서 xylitol dehydrogenase의 약 77%는 periplasmic space로 분비 발현되었음을 알 수 있었다. 또한 재조합 xylitol dehydrogenase의 효율적인 생산을 위해 탄소원의 영향을 조사해본 결과, glucose 단독보다 glucose와 xylose를 혼합 배양한 경우에서 효소활성이 최대 41% 정도 증가되었음을 확인 할 수 있었다. 본 연구에서 최적화한 발현 시스템 및 배양 조건은 xylose 뿐만 아니라 다양한 biomass를 이용한 유용물질 생산을 위한 관련 단백질의 발현 분비시스템 구축 및 대량생산에도 응용될 수 있을 것이라 생각된다.
Background: While qualitative analysis of methylation has been reviewed, the quantitative analysis of methylation has rarely been studied. We evaluated the methylation status of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions in non-small cell lung carcinomas (NSCLCs) by using pyrosequencing. Then, we evaluated the association between methylation at the promoter regions of these tumor suppressor genes and the clinicopathological parameters of the NSCLCs. Methods: We collected tumor tissues from a total of 53 patients with NSCLCs and analyzed the methylation level of the CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions by using pyrosequencing. In addition, we investigated the correlation between the hypermethylation of CDKN2A and the loss of $p16^{INK4A}$ immunoexpression. Results: Hypermethylation of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions were 16 (30.2%), 22 (41.5%), and 21 tumors (39.6%), respectively. The incidence of hypermethylation at the CDKN2A promoter in the tumors was higher in undifferentiated large cell carcinomas than in other subtypes (p=0.002). Hyperrmethylation of CDKN2A was significantly associated with $p16^{INK4A}$ immunoexpression loss (p=0.045). With regard to the clinicopathological characteristics of NSCLC, certain histopathological subtypes were found to be strongly associated with the loss of $p16^{INK4A}$ immunoexpression (p=0.016). Squamous cell carcinoma and undifferentiated large cell carcinoma showed $p16^{INK4A}$ immunoexpression loss more frequently. The Kaplan-Meier survival curves analysis showed that methylation level and patient survival were barely related to one another. Conclusion: We quantitatively analyzed the promoter methylation status by using pyrosequencing. We showed a significant correlation between CDKN2A hypermethylation and $p16^{INK4A}$ immunoexpression loss.
토양에서 분리한 알카리 내성 Bacillus sp. YA-14 의 promoter를 Bacillus promoter probe vector인 pPL703을 이용하여 Bacillus subtilis내에 cloning 하였다. 얻어진 형질전환체 중 promoter 활성이 가장 높은 균주의 CAT 비활성은 8.07로 expression vector인 pPL708의 CAT 비활성보다 2.5배 이상 높았으며 대수 증식기가 끝난 이후에 그 활성이 급격하게 증가하였다. 재조합 plasmid내의 삽입 DNA 단편은 그 크기가 2.8kb이고 제한효소 BamHI, Sal I 인식부위가 각각 한군데 존재하였다.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
To investigate high-level expression of Serratia marcescens metalloprotease (SMP) in Escherichia coli and S. marcescens, we constructed various recombinant plasmids: pSP2, containing SMP gene and lac promoter; pKSP2, containing SMP gene and tac promoter; pTSP2, containing SMP gene, trc99a promoter, and lacI$^{q}$. The recombinant E. coli (pKSP2) strain expressed SMP to a high-level, about 36% of total cellular proteins but accumulated inactive SMP precursors intracellularly, which indicated that E. coli does not have activation and secretion system for SMP. To overproduce active SMP, we transformed S. marcescens with the recombinant plasmids by a modified CaCl$_{2}$ method. The recombinant S. marcescens ATCC27117 (pSP2) containing lac promoter for SMP transcription produced 530 U/ml of active SMP on LB broth, which is about 5.1 times of the SMP yield, 105 U/ml of a control strain, S. marcescens ATCC27117 (pUC19). However, S. marcescens ATCC27117 (pKSP2) containing tac promoter for SMP transcription did not grow healthy and hardly produced SMP. To overcome a harmful effect of the strong tac promoter, we constructed a regulatory plasmid pTSP2 containing a strong trc99a promoter and its repressor gene lacI$^{q}$. When S. marcescens ATCC27117 (pTSP2) was induced with 1.0 mM IPTG after 9 hr cultivation, 2,200 U/ml of SMP was obtained in LB broth, which is about 21 times of that of a control strain.
Yao, Zhuang;Meng, Yu;Le, Huong Giang;Lee, Se Jin;Jeon, Hye Sung;Yoo, Ji Yeon;Kim, Jeong Hwan
Journal of Microbiology and Biotechnology
/
제31권6호
/
pp.833-839
/
2021
Bacillus subtilis CH3-5 isolated from cheonggukjang secretes a 28 kDa protease with a strong fibrinolytic activity. Its gene, aprE3-5, was cloned and expressed in a heterologous host (Jeong et al., 2007). In this study, the promoter of aprE3-5 was replaced with other stronger promoters (Pcry3A, P10, PSG1, PsrfA) of Bacillus spp. using PCR. The constructed chimeric genes were cloned into pHY300PLK vector, and then introduced into B. subtilis WB600. The P10 promoter conferred the highest fibrinolytic activity, i.e., 1.7-fold higher than that conferred by the original promoter. Overproduction of the 28 kDa protease was confirmed using SDS-PAGE and fibrin zymography. RT-qPCR analysis showed that aprE3-5 expression was 2.0-fold higher with the P10 promoter than with the original promoter. Change of the initiation codon from GTG to ATG further increased the fibrinolytic activity. The highest aprE3-5 expression was observed when two copies of the P10 promoter were placed in tandem upstream of the ATG initiation codon. The construct with P10 promoter and ATG and the construct with two copies of P10 promoter in tandem and ATG exhibited 117% and 148% higher fibrinolytic activity, respectively, than that exhibited by the construct containing P10 promoter and GTG. These results confirmed that significant overproduction of a fibrinolytic enzyme can be achieved by suitable promoter modification, and this approach may have applications in the industrial production of AprE3-5 and related fibrinolytic enzymes.
The nar promoter of Escherichia coli was known to induce maximally under anaerobic or microaerobic conditions in the presence of nitrate. In this study, the nar promoter was tested to see whether the expression level of a reporter gene which fused lacZ gene at nar promoter's downstream, in the some gram negative host strains(Agrobacterium, Pseudomonas and Rhizobium). A nar promoter system(Combination of nar promoter and gram negative strain) was grown under aerobic conditions to absorbance at 600 nm of nearly 2.0 and then, the nar promoter was induced by lowering DO to 1-2% with alternating microaerobic and aerobic condition in the fermentor cultures, using different gram negative hosts. For a wild type nar promoter (pNW61), it was possible to maintain production of ${\beta}-galactosidase$ activity per cell(specific ${\beta}-galactosidase$ activity) at 14,000, 9600, 45 Miller units in the presence of 1% nitrate. and for a nitrate - independent nar promoter (pNW618) at 12,000, 10,400 and 58 Miller units in the absence of nitrate ion, respectively.
Kim, Jin-Man;Park, Hee-Kyung;Park, Young-Seo;Yum, Do-Young;Bai, Dong-Hoon
Journal of Microbiology and Biotechnology
/
제3권3호
/
pp.146-155
/
1993
A DNA fragment from an alkali-tolerent Bacillus sp., conferring strong promoter activity, was subcloned into the promoter probe plasmid pPL703 and the nucleotide sequence of this promoter region was determined. The sequence analysis suggested that this highly efficient promoter region containing the complex clustered promoters comprised three kinds of promoters (P1, P2 and P3), which are transcribed by $\sigma^B (formerly \sigma^{37}), \sigma^E(formerly \sigma^{29}) and \sigma^A (formerly \sigma^{43})$ RNA polymerase holoenzymes which play major rules at the onset of endospore formation, during sporulation and at the vegetative phase of growth, respectively. S1 nuclease mapping experiments showed that all three promoters had staggered transcription initiation points. The results of chloramphenicol acetyltransferase assay after the subcloning experiments also indicated that the expression of these clustered promoters was correlated with the programs of growth and endospore development. Promoter P1, P2 and P3 were preceded by 75% AT, 79% AT and 81% AT regions, respectively, and a partial deletion of AT-rich region prevented transcription from promoter P1 in vivo. Two sets of 5 -AGTGTT-3 sequences and inverted repeat sequences located around the promoter P1 were speculated as the possible cis acting sites for the catabolite repression in B. subtilis. In vivo transcripts from these sequence regions may be able to form a secondary structure, however, the possibility that a regulatory protein induced by the excess amount of glucose could be bound to such a domain for crucial action remains to be determined.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.