• Title/Summary/Keyword: aP2 promoter

Search Result 704, Processing Time 0.024 seconds

알카리 내성 Bacillus속 Promoter의 특성 (Properties of Promoters from Alkali-tolerant Bacillus sp.)

  • 유주현;구본탁;박영서;정용준;배동훈;오두환
    • 한국미생물·생명공학회지
    • /
    • 제16권5호
    • /
    • pp.343-347
    • /
    • 1988
  • 토양에서 분리한 알칼리 내성 Bacillus속의 chromosomal DNA로부터 promoter를 cloning하여 선별된 재조합 plasmid p-12내 의 promoter를 subcloning을 하였다. 그 결과 cloning된 promoter 내에는 서로 다른 두 가지의 promoter가 존재하는 것을 확인할 수 있었고 이로부터 각각의 promoter를 함유한 재조합 plasmid p-l2B1, p-l2B2를 제조하였다. 또한 CAT 비활성 측정에 의해 각 promoter의 활성을 비교해 본 결과 p-l2B1의 promoter는 p-l2B2의 promoter에 비해 상대적으로 높은 활성을 가지고 있었다. CAT 비활성을 생육시기에 따라 측정해 본 결과 p-l2B1과 p-l2B2는 대수증식기 이후 활성이 급증되었으며 배지 중 첨가된 1.0%의 glucose에 의해 활성이 억제되는 효과를 받았다.

  • PDF

Analysis of Two Promoters that Control the Expression of the GTP cyclohydrolase I Gene in Drosophila melanogaster

  • Byun, Jaegoo;Yoon, Jaeseung;Baek, Kwanghee
    • Molecules and Cells
    • /
    • 제27권5호
    • /
    • pp.583-589
    • /
    • 2009
  • GTP cyclohydrolase I (GTPCH) is a key enzyme in the de novo synthesis of tetrahydrobiopterin. Previously, the Drosophila melanogaster GTPCH gene has been shown to be expressed from two different promoters (P1 and P2). In our study, the 5'-flanking DNA regions required for P1 and P2 promoter activities were characterized using transient expression assay. The DNA regions between -98 and +31, and between -73 and +35 are required for efficient P1 and P2 promoter activities, respectively. The regions between -98 and -56 and between -73 and -41 may contain critical elements required for the expression of GTPCH in Drosophila. By aligning the nucleotide sequences in the P1 and P2 promoter regions of the Drosophila melanogaster and Drosophila virilrs GTPCH genes, several conserved elements including palindromic sequences in the regions critical for P1 and P2 promoter activities were identified. Western blot analysis of transgenic flies transformed using P1 or P2 promoter-lacZ fusion plasmids further revealed that P1 promoter expression is restricted to the late pupae and adult developmental stages but that the P2 promoter driven expression of GTPCH is constitutive throughout fly development. In addition, X-gal staining of the embryos and imaginal discs of transgenic flies suggests that the P2 promoter is active from stage 13 of embryo and is generally active in most regions of the imaginal discs at the larval stages.

출아효모에서 xylitol dehydrogenase (XYL2)의 최적 생산을 위한 발현 시스템 구축 (Expression System for Optimal Production of Xylitol Dehydrogenase (XYL2) in Saccharomyces cerevisiae)

  • 정회명;김연희
    • 생명과학회지
    • /
    • 제27권12호
    • /
    • pp.1403-1409
    • /
    • 2017
  • 본 연구에서는 lignocellulosic biomass (xylose)의 부가가치를 높이고 효율적인 활용을 위해 xylitol dehydrogenase를 Saccharomyces cerevisiae 숙주세포에서 분비 생산하고자 하였다. 먼저 S. cerevisiae와 Pichia stipitis유래 XYL2 유전자(S.XYL2 and P.XYL2 gene)의 발현 시스템을 구축하기 위하여 GAL10 promoter와 ADH1 promoter 하류에 각각 mating factor ${\alpha}$ ($MF{\alpha}$) signal sequence와 XYL2유전자를 가진 $pGMF{\alpha}-S.XYL2$, $pGMF{\alpha}-P.XYL2$, $pAMF{\alpha}-S.XYL2$$pAMF{\alpha}-P.XYL2$ plasmid를 구축하였다. 각각의 plasmid는 S. cerevisiae $SEY2102{\Delta}trp1$ 균주에 형질전환되었고, 생산된 xylitol dehydrogenase의 활성을 조사해 본 결과, GAL10 promoter가 ADH1 promoter보다 XYL2유전자의 발현에 더욱 적합함을 확인 할 수 있었다. 또한 P. stipitis 유래의 xylitol dehydrogenase 효소 활성이 S. cerevisiae 유래의 효소 활성보다 2배 이상 더 높았으며, 활성의 증가를 위해 두 유전자 모두 cofactor로 $NAD^+$에 의존한다는 것을 확인하였다. 재조합 유전자가 가지는 분비서열에 의해 $SEY2102{\Delta}trp1/pGMF{\alpha}-P.XYL2$ 균주에서 xylitol dehydrogenase의 약 77%는 periplasmic space로 분비 발현되었음을 알 수 있었다. 또한 재조합 xylitol dehydrogenase의 효율적인 생산을 위해 탄소원의 영향을 조사해본 결과, glucose 단독보다 glucose와 xylose를 혼합 배양한 경우에서 효소활성이 최대 41% 정도 증가되었음을 확인 할 수 있었다. 본 연구에서 최적화한 발현 시스템 및 배양 조건은 xylose 뿐만 아니라 다양한 biomass를 이용한 유용물질 생산을 위한 관련 단백질의 발현 분비시스템 구축 및 대량생산에도 응용될 수 있을 것이라 생각된다.

Promoter Methylation of CDKN2A, $RAR{\beta}$, and RASSF1A in Non-Small Cell Lung Carcinoma: Quantitative Evaluation Using Pyrosequencing

  • Lee, Jung Uee;Sul, Hae Joung;Son, Ji Woong
    • Tuberculosis and Respiratory Diseases
    • /
    • 제73권1호
    • /
    • pp.11-21
    • /
    • 2012
  • Background: While qualitative analysis of methylation has been reviewed, the quantitative analysis of methylation has rarely been studied. We evaluated the methylation status of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions in non-small cell lung carcinomas (NSCLCs) by using pyrosequencing. Then, we evaluated the association between methylation at the promoter regions of these tumor suppressor genes and the clinicopathological parameters of the NSCLCs. Methods: We collected tumor tissues from a total of 53 patients with NSCLCs and analyzed the methylation level of the CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions by using pyrosequencing. In addition, we investigated the correlation between the hypermethylation of CDKN2A and the loss of $p16^{INK4A}$ immunoexpression. Results: Hypermethylation of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions were 16 (30.2%), 22 (41.5%), and 21 tumors (39.6%), respectively. The incidence of hypermethylation at the CDKN2A promoter in the tumors was higher in undifferentiated large cell carcinomas than in other subtypes (p=0.002). Hyperrmethylation of CDKN2A was significantly associated with $p16^{INK4A}$ immunoexpression loss (p=0.045). With regard to the clinicopathological characteristics of NSCLC, certain histopathological subtypes were found to be strongly associated with the loss of $p16^{INK4A}$ immunoexpression (p=0.016). Squamous cell carcinoma and undifferentiated large cell carcinoma showed $p16^{INK4A}$ immunoexpression loss more frequently. The Kaplan-Meier survival curves analysis showed that methylation level and patient survival were barely related to one another. Conclusion: We quantitatively analyzed the promoter methylation status by using pyrosequencing. We showed a significant correlation between CDKN2A hypermethylation and $p16^{INK4A}$ immunoexpression loss.

알카리 내성 Bacillus속 Promoter의 Cloning (Cloning of Promoters from Alkali-tolerant Bacillus sp.)

  • 유주현;구본탁;공인수;정용준;박영서
    • 한국미생물·생명공학회지
    • /
    • 제16권2호
    • /
    • pp.126-130
    • /
    • 1988
  • 토양에서 분리한 알카리 내성 Bacillus sp. YA-14 의 promoter를 Bacillus promoter probe vector인 pPL703을 이용하여 Bacillus subtilis내에 cloning 하였다. 얻어진 형질전환체 중 promoter 활성이 가장 높은 균주의 CAT 비활성은 8.07로 expression vector인 pPL708의 CAT 비활성보다 2.5배 이상 높았으며 대수 증식기가 끝난 이후에 그 활성이 급격하게 증가하였다. 재조합 plasmid내의 삽입 DNA 단편은 그 크기가 2.8kb이고 제한효소 BamHI, Sal I 인식부위가 각각 한군데 존재하였다.

  • PDF

Agrobacterium tumefaciens pTiA6 플라스미드의 virE 프로모터내 조절부위의 구조적 특성 (Structural Characterization of the Regulatory Site in virE Promoter of Agrobacterium tumefaciens pTiA6 Plasmid)

  • 음진성
    • Journal of Plant Biology
    • /
    • 제35권2호
    • /
    • pp.155-163
    • /
    • 1992
  • 식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

  • PDF

대장균과 Serratia marcescens에서 Serratia marcescens Metalloprotease(SMP) 유전자의 발현 (Expression of Serratia marcescens Metalloprotease(SMP)Gene in Escherichia coli and Serratia marcescens)

  • 김기석;정재연;박군식;김태운;변시명;신용철
    • 한국미생물·생명공학회지
    • /
    • 제23권3호
    • /
    • pp.288-296
    • /
    • 1995
  • To investigate high-level expression of Serratia marcescens metalloprotease (SMP) in Escherichia coli and S. marcescens, we constructed various recombinant plasmids: pSP2, containing SMP gene and lac promoter; pKSP2, containing SMP gene and tac promoter; pTSP2, containing SMP gene, trc99a promoter, and lacI$^{q}$. The recombinant E. coli (pKSP2) strain expressed SMP to a high-level, about 36% of total cellular proteins but accumulated inactive SMP precursors intracellularly, which indicated that E. coli does not have activation and secretion system for SMP. To overproduce active SMP, we transformed S. marcescens with the recombinant plasmids by a modified CaCl$_{2}$ method. The recombinant S. marcescens ATCC27117 (pSP2) containing lac promoter for SMP transcription produced 530 U/ml of active SMP on LB broth, which is about 5.1 times of the SMP yield, 105 U/ml of a control strain, S. marcescens ATCC27117 (pUC19). However, S. marcescens ATCC27117 (pKSP2) containing tac promoter for SMP transcription did not grow healthy and hardly produced SMP. To overcome a harmful effect of the strong tac promoter, we constructed a regulatory plasmid pTSP2 containing a strong trc99a promoter and its repressor gene lacI$^{q}$. When S. marcescens ATCC27117 (pTSP2) was induced with 1.0 mM IPTG after 9 hr cultivation, 2,200 U/ml of SMP was obtained in LB broth, which is about 21 times of that of a control strain.

  • PDF

Increase of a Fibrinolytic Enzyme Production through Promoter Replacement of aprE3-5 from Bacillus subtilis CH3-5

  • Yao, Zhuang;Meng, Yu;Le, Huong Giang;Lee, Se Jin;Jeon, Hye Sung;Yoo, Ji Yeon;Kim, Jeong Hwan
    • Journal of Microbiology and Biotechnology
    • /
    • 제31권6호
    • /
    • pp.833-839
    • /
    • 2021
  • Bacillus subtilis CH3-5 isolated from cheonggukjang secretes a 28 kDa protease with a strong fibrinolytic activity. Its gene, aprE3-5, was cloned and expressed in a heterologous host (Jeong et al., 2007). In this study, the promoter of aprE3-5 was replaced with other stronger promoters (Pcry3A, P10, PSG1, PsrfA) of Bacillus spp. using PCR. The constructed chimeric genes were cloned into pHY300PLK vector, and then introduced into B. subtilis WB600. The P10 promoter conferred the highest fibrinolytic activity, i.e., 1.7-fold higher than that conferred by the original promoter. Overproduction of the 28 kDa protease was confirmed using SDS-PAGE and fibrin zymography. RT-qPCR analysis showed that aprE3-5 expression was 2.0-fold higher with the P10 promoter than with the original promoter. Change of the initiation codon from GTG to ATG further increased the fibrinolytic activity. The highest aprE3-5 expression was observed when two copies of the P10 promoter were placed in tandem upstream of the ATG initiation codon. The construct with P10 promoter and ATG and the construct with two copies of P10 promoter in tandem and ATG exhibited 117% and 148% higher fibrinolytic activity, respectively, than that exhibited by the construct containing P10 promoter and GTG. These results confirmed that significant overproduction of a fibrinolytic enzyme can be achieved by suitable promoter modification, and this approach may have applications in the industrial production of AprE3-5 and related fibrinolytic enzymes.

Characterization of an Oxygen-Dependent Inducible Promoter Systems, the nar Promoter of Escherichia coli, and Gram negative host strains

  • 이길호;조무환;이종원
    • 한국생물공학회:학술대회논문집
    • /
    • 한국생물공학회 2001년도 추계학술발표대회
    • /
    • pp.762-766
    • /
    • 2001
  • The nar promoter of Escherichia coli was known to induce maximally under anaerobic or microaerobic conditions in the presence of nitrate. In this study, the nar promoter was tested to see whether the expression level of a reporter gene which fused lacZ gene at nar promoter's downstream, in the some gram negative host strains(Agrobacterium, Pseudomonas and Rhizobium). A nar promoter system(Combination of nar promoter and gram negative strain) was grown under aerobic conditions to absorbance at 600 nm of nearly 2.0 and then, the nar promoter was induced by lowering DO to 1-2% with alternating microaerobic and aerobic condition in the fermentor cultures, using different gram negative hosts. For a wild type nar promoter (pNW61), it was possible to maintain production of ${\beta}-galactosidase$ activity per cell(specific ${\beta}-galactosidase$ activity) at 14,000, 9600, 45 Miller units in the presence of 1% nitrate. and for a nitrate - independent nar promoter (pNW618) at 12,000, 10,400 and 58 Miller units in the absence of nitrate ion, respectively.

  • PDF

Structure and Regulation of a Complex Promoter Region from an Alkali-tolerent Bacillus sp.

  • Kim, Jin-Man;Park, Hee-Kyung;Park, Young-Seo;Yum, Do-Young;Bai, Dong-Hoon
    • Journal of Microbiology and Biotechnology
    • /
    • 제3권3호
    • /
    • pp.146-155
    • /
    • 1993
  • A DNA fragment from an alkali-tolerent Bacillus sp., conferring strong promoter activity, was subcloned into the promoter probe plasmid pPL703 and the nucleotide sequence of this promoter region was determined. The sequence analysis suggested that this highly efficient promoter region containing the complex clustered promoters comprised three kinds of promoters (P1, P2 and P3), which are transcribed by $\sigma^B (formerly \sigma^{37}), \sigma^E(formerly \sigma^{29}) and \sigma^A (formerly \sigma^{43})$ RNA polymerase holoenzymes which play major rules at the onset of endospore formation, during sporulation and at the vegetative phase of growth, respectively. S1 nuclease mapping experiments showed that all three promoters had staggered transcription initiation points. The results of chloramphenicol acetyltransferase assay after the subcloning experiments also indicated that the expression of these clustered promoters was correlated with the programs of growth and endospore development. Promoter P1, P2 and P3 were preceded by 75% AT, 79% AT and 81% AT regions, respectively, and a partial deletion of AT-rich region prevented transcription from promoter P1 in vivo. Two sets of 5 -AGTGTT-3 sequences and inverted repeat sequences located around the promoter P1 were speculated as the possible cis acting sites for the catabolite repression in B. subtilis. In vivo transcripts from these sequence regions may be able to form a secondary structure, however, the possibility that a regulatory protein induced by the excess amount of glucose could be bound to such a domain for crucial action remains to be determined.

  • PDF