• Journal of Plant Biology
• /
• 제35권2호
• /
• pp.155-163
• /
• 1992

식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5＇-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5＇-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5＇-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

• KSBB Journal
• /
• 제5권3호
• /
• pp.247-253
• /
• 1990

고등식물의 형질전환용 유전자운반체로써 가장 많이 사용되고 있는 Ti-plasmid를 이용해서 당근세포를 형질 전환시키기 위한 연구의 일환으로 Agrobacterium spp를 helper로 이용하여 NPT II gene를 함유하고 있는 binary vector GA472를 당근세포에 삽입시켜 kanamycin에 대해 저항성을 나타내는 세포주를 선발하고자 본 연구를 수행하였다. 국내 토양에서 선발한 A.tumefaciens 2종과 disarmes된 PC2760 그리고 hypervirulent균주인 A281에 tri-parental mating 방법에 의해서 binary vector인 pGA472을 도입하여 transconjungants인 A. tumefaciens c-23-1/pGA472,K29-1/pGA472, PC2760/PGA472 그리고 A281/pGA472를 획득하였다. Transconjungants는 plasmid의 분리, 정제방법에 의해서 추출한 후 0.7% agarose gel 상에서 관찰해 본 결과 4균주 공히 NTPII gene이 삽입된 pGA472와 Ti-plasmid를 함유하고 있는 것을 확인 하였다. 확인된 conjugant와 당근정상조직을 동시배양방법에 의해서 형질전환을 유도한 후 정상조직은 전혀 생존이 되지않은 kanamycin에 대해서 저항을 나타내는 callus를 선발할 수 있었다.

• 식물조직배양학회지
• /
• 제25권3호
• /
• pp.207-217
• /
• 1998

한국에서 자생한 자연산 tumor 조직과 근권토양으로부터 형질전환율이 높은 hypervirulent Agrobacterium spp를 분리하기 위해서 Salix, Diospyros, Populus 및 Malus에서 형성된 tumor 조직과 근권토양을 채취하괴 Schroth 선택배지와 New and Kerr 배지를 이용하여 78 균주의 colony를 특성에 따라 분리하였다. 이중에서 48 균주가 당근 disc에서 tumor를 형성하였으며 tumor를 형성한 균주중 형성시기가 빠르며 크기가 커 hypervirulent 균주로 생각되는 A. tumefaciens SP101을 biotype 1, 그리고 A. tumefaciens SM042를 biotype 2로 동정하였다. 토양중에서 선발한 A. tumefaciens SM042와 disarmed A. tumefaciens PC2760에 kanamycin 저항성 유전자를 함유하고 있는 binary vector pGA643을 도입하여 conjugant인 A. tumefaciens SM643과 A. tumefaciens PC643을 kanamycin과 tetracycline이 함유된 최소배지에서 획득하였다. 연초의 형질전환을 위해서 conjugant Agrobacterium과 연초조직을 동시배양 후 2,4-D와 kanamycin이 함유된 선발배지에 치상하여 형질전환을 유도한 결과 A. tumefaciens SM643이 A. tumefaciens PC643보다 더 많은 캘러스가 형성되었다. 그러나 A. tumefaciens PC643을 사용한 형질전환 캘러스는 대부분 friable한 캘러스로 유도되었으며 정상적으로 식물체로 생장하였으나 A. tumefaciens SM643을 사용한 캘러스는 매우 딱딱하며 둥그런 형태의 캘러스와 friable한 캘러스가 혼재한 상태로 생장하였으며, 이중에서 friable한 캘러스는 정상적인 shoot가 형성되었으나 딱딱한 캘러스로 유도된 형질전환체는 식물체로 형성되지 않고 반구형 미색의 전형적인 tumor 캘러스로 생장하였다. 한편 형질전환시 캘러스를 유도하지 않고 직접 shoot를 형성시킨 결과 disarmed Ti-plasmid를 사용하지 않고 wild-type Ti-plasmid를 사용해도 정상적인 형질전환체를 획득할 수 있었다.

• Journal of Yeungnam Medical Science
• /
• 제1권1호
• /
• pp.41-48
• /
• 1984

한국형 Agrobacterium tumefaciens의 분리 및 tumor inducing ($T_1$) plasmid의 유전적 특성을 비교 관찰하여 다음과 같은 결론을 얻었다. Agrobacterium군은 사과나무($A_1-A_3$), 미류나무($W_1{\sim}W_6$), 은사씨나무($P_1-P_3$) 및 장미($R_1$)의 crown gall tumor에서 도합 13종을 분리하였으며 각 군의 plasmid를 관찰한 결과 ATCC 15955보다 $P_1$ 및 $A_2$가 크기가 컸으며 $W_2$, $W_3$, $W_6$ 및 $P_3$는 작았으며 각균의 tumor 유도는 해바라기에 ATCC 15955와 Korean type $W_2$ ($KW_2$)을 접종한 것에서만 각각 접종 4주 및 6주만에 crown gall을 관찰하였다. 아울러 두균종의 $T_1$ plasmid($pT_1$)를 정제하여 몇종의 게한효소를 처리 하였으며 $pT_i$ ATCC 15955와 $pT_1KW_2$는 EcoR I 처리로 25개 및 27개의 band를, Hind III로 23개와 21개, BamH I으로 각각 20개 및 Hpa I으로 12개 및 27개의 band를 관찰하였으며 크기는 $pT_i$ ATCC 15955가 200 kbases(kb)로 $pT_1KW_2$가 87 kb로 관찰 되었다. 아울러 cctopine은 $W_1-W_6$ 및 $P_1-P_3$균에 의한 tumor조직에서 관찰 되었고 이들균을 octopine type균으로 사료 되었다.

• Journal of Microbiology and Biotechnology
• /
• 제16권1호
• /
• pp.118-125
• /
• 2006

The region responsible for replication of the megaplasmid pAtC58 in the nopaline-type Agrobacterium tumefaciens strain C58 was determined. A derivative ofa Co1E1 vector, pBluscript SK-, incapable of autonomous replication in Agrobacterium spp, was cloned with a 7.6-kb Bg1II-HindIII fragment from a cosmid clone of pAtC58, which contains a region adjacent to the operon for the utilization of deoxyfructosyl glutamine (DFG). The resulting plasmid conferred resistance to carbenicillin on the A. tumefaciens strain UIA5 that is a plasmidfree derivative of C58. The plasmid was stably maintained in the strain even after consecutive cultures for generations. Analysis of nested deletions of the 7.6-kb fragment showed that a 4.3-kb BglII-XhoI region sufficiently confers replication of the derivative of the ColE1 vector on UIA5. The region comprises three ORFs, which have high homologies with repA, repB, and repC of plasm ids in virulent Agrobacterium spp. including pTiC58, pTiB6S3, pTi-SAKURA, and pRiA4b as well as those of symbiotic plasmids from Rhizobium spp. Phylogenie analysis showed that rep genes in pAtC58 are more closely related to those in pRiA4 than to pTi plasmids including pTiC58, suggesting that the two inborn plasmids, pTiC58 and pAtC58, harbored in C58 evolved from distinct origins.

• 식물조직배양학회지
• /
• 제22권4호
• /
• pp.195-200
• /
• 1995

동물유전자인 mouse adenosine deaminase (ADA)유전자가 안정적으로 연초 형질전환체에서 발현되었다. ADA cDNA 을 연초에서 강력히 발현시키기 위해서 35S/35S/AMV promoter을 부착시켰으며 식물세포에 도입을 위해서 binary vector인 pRD400을 이용하였다. 연초의 형질전환은 Tri- parental mating에 의해서 도입된 ADA 유전자 함유 binary vector와 disarmed Ti-plasmid을 함유하고 있는 Agrobacterium tmefacience MP9O을 사용하였다. 동시배양은 연초의 잎 disc을 이용해서 kanamycin이 첨가된 배지로부터 직접 shoots을 선발하여 형질전환체로 유도하였다. 형질전환 체에 ADA 유전자의 삽입여부는 PCR을 이용하였으며, 실험결과 ADA 유전자를 확인할 수 있었다. 또한 도입된 mouse ADA 유전자로부터 mRNA 및 단백질 합성여부를 각각 northern blot 및 immunoblot 분석한 결과 형질전환체 에서는 공히 확인되었다.

• Journal of Plant Biology
• /
• 제33권2호
• /
• pp.97-104
• /
• 1990

In order to investigate the host range of Agrobacterium tumefaciens KU12 containing pTi-12, 28 species of dicotyledonous plants were infected with KU12, A136 without Ti plasmid and A348 containing pTi A6, respectively. KU12 and A348 induced tumor in 20 species and 14 species, respectively. This results showed that KU12 has a wide host range. Therefore, it was confirmed that KU12 and pTi-12 are very useful for developing plant vector system having a broad host range.

• 한국미생물학회:학술대회논문집
• /
• 한국미생물학회 1997년도 제37회 춘계학술발표대회
• /
• pp.62.2-62.2
• /
• 1997

• 한국동물학회:학술대회논문집
• /
• 한국동물학회 1995년도 한국생물과학협회 학술발표대회
• /
• pp.311.1-311
• /
• 1995

• Journal of Plant Biology
• /
• 제38권1호
• /
• pp.19-24
• /
• 1995

The vir genes expression of Ti plasmid is induced by a family of related phenolic compounds. We investigated the effects of various phenolic compounds, Ti plasmids and hosts on the expression of the vir genes in the same type of octopine Ti plasmids, pTiKU12, pTiAch5 and pTiA6. The vir gene induction of pTiKU12 was remarkably stimulated by p-coumaric acid in relation to acetosyringone, but those of pTiAch5 and pTiA6 were more stimulated by acetosyringone than by p-coumaric acid. The effect of phenolic compound on the vir gene induction was different according to the kind of Ti plasmids. Also, the vir gene expression of A. tumefaciens KU913, which has pTiKU12 was about 6.2 times as much as that of A. tumefaciens KU915, which has pTiKU12 in KU12 host, in the presence of ferulic acid. But no difference was shown in the presence of p-coumaric acid. The vir gene induction abilities of phenolic compounds are different according to the kinds of phenolic compounds, Ti plasmids and hosts.