• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Ginseng Research
• /
• v.44 no.5
• /
• pp.725-737
• /
• 2020

Background: T-cell acute lymphoblastic leukemia (T-ALL) is a kind of aggressive hematological cancer, and the PI3K/Akt/mTOR signaling pathway is activated in most patients with T-ALL and responsible for poor prognosis. 20(S)-Ginsenoside Rh2 (20(S)-GRh2) is a major active compound extracted from ginseng, which exhibits anti-cancer effects. However, the underlying anticancer mechanisms of 20(S)-GRh2 targeting the PI3K/Akt/mTOR pathway in T-ALL have not been explored. Methods: Cell growth and cell cycle were determined to investigate the effect of 20(S)-GRh2 on ALL cells. PI3K/Akt/mTOR pathway-related proteins were detected in 20(S)-GRh2-treated Jurkat cells by immunoblotting. Antitumor effect of 20(S)-GRh2 against T-ALL was investigated in xenograft mice. The mechanisms of 20(S)-GRh2 against T-ALL were examined by cell proliferation, apoptosis, and autophagy. Results: In the present study, the results showed that 20(S)-GRh2 decreased cell growth and arrested cell cycle at the G1 phase in ALL cells. 20(S)-GRh2 induced apoptosis through enhancing reactive oxygen species generation and upregulating apoptosis-related proteins. 20(S)-GRh2 significantly elevated the levels of pEGFP-LC3 and autophagy-related proteins in Jurkat cells. Furthermore, the PI3K/Akt/mTOR signaling pathway was effectively blocked by 20(S)-GRh2. 20(S)-GRh2 suppressed cell proliferation and promoted apoptosis and autophagy by suppressing the PI3K/Akt/mTOR pathway in Jurkat cells. Finally, 20(S)-GRh2 alleviated symptoms of leukemia and reduced the number of white blood cells and CD3 staining in the spleen of xenograft mice, indicating antitumor effects against T-ALL in vivo. Conclusion: These findings indicate that 20(S)-GRh2 exhibits beneficial effects against T-ALL through the PI3K/Akt/mTOR pathway and could be a natural product of novel target for T-ALL therapy.

• Korean Journal of Mathematics
• /
• v.16 no.2
• /
• pp.215-231
• /
• 2008

Let E be a uniformly convex Banach space with a uniformly $G{\hat{a}}teaux$ differentiable norm, C a nonempty closed convex subset of E, and $T:C{\rightarrow}{\mathcal{K}}(E)$ a multivalued nonself-mapping such that $P_T$ is nonexpansive, where $P_T(x)=\{u_x{\in}Tx:{\parallel}x-u_x{\parallel}=d(x,Tx)\}$. For $f:C{\rightarrow}C$ a contraction and $t{\in}(0,1)$, let $x_t$ be a fixed point of a contraction $S_t:C{\rightarrow}{\mathcal{K}}(E)$, defined by $S_tx:=tP_T(x)+(1-t)f(x)$, $x{\in}C$. It is proved that if C is a nonexpansive retract of E and $\{x_t\}$ is bounded, then the strong ${\lim}_{t{\rightarrow}1}x_t$ exists and belongs to the fixed point set of T. Moreover, we study the strong convergence of $\{x_t\}$ with the weak inwardness condition on T in a reflexive Banach space with a uniformly $G{\hat{a}}teaux$ differentiable norm. Our results provide a partial answer to Jung's question.

• Transactions of the Korean Society of Mechanical Engineers A
• /
• v.34 no.4
• /
• pp.457-465
• /
• 2010

In this study, a Taylor series (T-S) model based on the Arrhenius, McVetty, and Monkman-Grant equations was developed using a mathematical analysis. In order to reduce fitting errors, the McVetty equation was transformed by considering the first three terms of the Taylor series equation. The model parameters were accurately determined by a statistical technique of maximum likelihood estimation, and this model was applied to the creep data of alloy 617. The T-S model results showed better agreement with the experimental data than other models such as the Eno, exponential, and L-M models. In particular, the T-S model was converted into an isothermal Taylor series (IT-S) model that can predict the creep strength at a given temperature. It was identified that the estimations obtained using the converted ITS model was better than that obtained using the T-S model for predicting the long-term creep life of alloy 617.

• The Korean Journal of Zoology
• /
• v.26 no.3
• /
• pp.211-217
• /
• 1983

Genetic polymorphism of transferrin $(T_f)$ subtypes in Jeju population was studied by isoelectric focusing of human sera on polyacrylamide gels under high voltage, and haptolobin (Hp) polymorphism in Seoul and Jeju population was studied by polyacrylamide gel electrophoresis. Among 946 normal samples, three common types of transferrin, $T_{f}C_{1}, T_{f}C_{1}-C_{2} and T_{f}C_{2}$ were observed with some variants migrating slower than $T_{f}C$ subtypes, while among 139 patient (hepatitis) samples, only three common types were found. The gene frequencies were calculated as follows; in normal population, $T_{f}C^{1}$ was 0.7220; $T_{f}C^{2}, 0.2743; T_{f}D^{Jeju}, 0.0037$, and in patient population, $T_{f}C^{1} was 0.7194; T_{f}C^{2}, 0.2806$ respectively. Among 460 samples in Seoul and 502 in Jeju population, three types of haptoglobin, Hp 1-1, Hp 2-1 and Hp 2-2 were observed. The gene frequency of $Hp^1$ was 0.304, $Hp^2$, 0.696 in Seoul and in Jeju, $Hp^1$ was 0.269 and $Hp^2$, 0.731, respectively. The frequencies of the genes and the polymorphic phenotypes were discussed comparatively with the other populations.

• Journal of the Korea Institute of Information Security & Cryptology
• /
• v.18 no.2
• /
• pp.3-10
• /
• 2008

The choice of basis for representation of element in $GF(2^m)$ affects the efficiency of a multiplier. Among them, a multiplier using redundant representation efficiently supports trade-off between the area complexity and the time complexity since it can quickly carry out modular reduction. So time of a previous multiplier using redundant representation is faster than time of multiplier using others basis. But, the weakness of one has a upper space complexity compared to multiplier using others basis. In this paper, we propose a new efficient multiplier with consideration that polynomial exponentiation operations are frequently used in cryptographic hardwares. The proposed multiplier is suitable fer left-to-right exponentiation environment and provides efficiency between time and area complexity. And so, it has both time delay of $T_A+({\lceil}{\log}_2m{\rceil})T_x$ and area complexity of (2m-1)(m+s). As a result, the proposed multiplier reduces $2(ms+s^2)$ compared to the previous multiplier using equally-spaced polynomials in area complexity. In addition, it reduces $T_A+({\lceil}{\log}_2m+s{\rceil})T_x$ to $T_A+({\lceil}{\log}_2m{\rceil})T_x$ in the time complexity.($T_A$:Time delay of one AND gate, $T_x$:Time delay of one XOR gate, m:Degree of equally spaced irreducible polynomial, s:spacing factor)

• The Korean Society of Law and Medicine
• /
• v.21 no.2
• /
• pp.209-244
• /
• 2020

TMS and tDCS are non-invasive devices that treat the diseases of patients or individual users, and manage or improve their health by applying stimulation to a brain through magnetism and electricity. The effect and safety of these devices have proved to be valid in several diseases, but research in this area is still much going on. Despite increasing cases of their application, legislations directly regulating TMS and tDCS are hard to find. Legal regulation regarding TMS and tDCS in the United States, Germany and Japan reveals that while TMS has been approved as a medical device with a moderate risk, tDCS has not yet earned approval as a medical device. However, the recent FDA guidance, European MDR changes, recalls in the US, and relevant legal provisions of Germany and Japan, as well as recommendations from expert groups all show signs of tDCS growing closer to getting approved as a medical device. Of course, safety and efficacy of tDCS can still be regulated as a general product instead of as a medical device. Considering multiple potential impacts on a human brain, however, the need for independent regulation is urgent. South Korea also lacks legal provisions explicitly regulating TMS and tDCS, but they fall into the category of the grade 3 medical devices according to the notifications of the Korean Ministry of Food and Drug Safety. And safety and efficacy of TMS are to be evaluated in compliance with the US FDA guidance. But no specific guidelines exist for tDCS yet. Given that tDCS devices are used in some hospitals in reality, and also at home by individual buyers, such a regulatory gap must quickly be addressed. In a longer term, legal system needs to be in place capable of independently regulating non-invasive brain stimulating devices.

• The Korean Journal of Food And Nutrition
• /
• v.17 no.4
• /
• pp.412-419
• /
• 2004

In odor to select optimum extraction methods of volatile compounds in beef extract powder(BEP) as basic data for the development of a new detection method of irradiated BEP, four extraction methods, such as solid phase microextraction with polar fiber(S-PD) and non-polar fiber(S-CD), purge and trap(P&T) and liquid liquid continuous extraction(LLCE) methods, were tested with gas chromatography/mass spectrometry method. A total of 106 volatile compounds including 22 hydrocarbons, 7 aldehydes, 6 ketones, 13 alcohols, 6 sulfur-containing compounds, 19 nitrogen-containing compounds, 6 aromatic compounds, 17 terpenes, 8 furans and 2 miscellaneous compounds were detected in BEP by four detection methods. The most compounds(62 compounds) were detected by S-PD method, followed by P&T(43), LLCE(38) and S-CD method(30). Among these methods, S-PD and P&T methods showed a complementary interrelationship to detect volatile compounds as S-PD method showed high detectabiltiy to all compound groups except hydrocarbons and ketones, which had high volatility and low molecular weight(less than RI 1200), but P&T method showed the contrary pattern to that of S-PD method. Moreover, the most of volatile compounds detected by S-CD and LLCE methods were also detectable by S-PD or/and P&T methods. Therefore, the simultaneous application of S-PD and P&T methods were selected as the optimum volatile extraction methods of BEP.

• Fashion & Textile Research Journal
• /
• v.7 no.3
• /
• pp.346-350
• /
• 2005

In this study, to investigate the influence on the seam puckering by the mechanical properties of textiles, it was measured from 4 polyester/cotton samples. We reached the following conclusion in influences of the seam puckering by the thread, iron and laundry. Seam puckering is occurred several times by repeating the laundry. according to iron method, the seam puckering is stronger in order of T/C1> T/C2> T/C3> T/C4 by the samples and order of 40's/2> 60's/3> 50's/2> 60's/2 by the threads, the relation between sample's mechanical properties and seam strength and obtainment of formula. We can find that seam puckering is related with B, 2HB, G, 2HG5, RC, T among the mechanical properties and the estimated formulas which get from mechanical factors.

• Proceedings of the Korean Society of Computer Information Conference
• /
• 2021.01a
• /
• pp.313-316
• /
• 2021

사물 인터넷 시스템에서 서버와 클라이언트의 신뢰성 확보는 매우 중요하다. 대부분의 IoT 시스템에서 신뢰성 확보를 위해 인증서 기법이 사용되고 있다. 인증서 기법을 사용하는 IoT 시스템은 데이터(인증서,공개키) 탈취 및 분실 취약점이 있다. 이러한 취약점을 강화하기 위해 서버와 클라이언트는 서로 주고받는 데이터의 무결성과 신뢰성을 보장할 수 있는 환경이 구축되어야 한다. 본 논문에서는 이러한 취약점을 보완하기 위하여 IPFS와 블록체인을 결합한 인증 강화 기법을 제시한다. 제시한 기법의 기본 개념은 IPFS를 이용하여 CA와 서버의 인증서와 공개키를 분산 저장하고, IPFS에 저장한 인증서와 공개키의 Content-Address를 블록체인에 보관한다. 마지막으로 제시한 기법의 타당성을 검토하기 위하여 Mobius, nCube, Ethereum, IPFS를 결합한 IoT 시스템을 구축하고 SSL을 사용한 인증 과정을 실험한다.