One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.
Background: T-cell acute lymphoblastic leukemia (T-ALL) is a kind of aggressive hematological cancer, and the PI3K/Akt/mTOR signaling pathway is activated in most patients with T-ALL and responsible for poor prognosis. 20(S)-Ginsenoside Rh2 (20(S)-GRh2) is a major active compound extracted from ginseng, which exhibits anti-cancer effects. However, the underlying anticancer mechanisms of 20(S)-GRh2 targeting the PI3K/Akt/mTOR pathway in T-ALL have not been explored. Methods: Cell growth and cell cycle were determined to investigate the effect of 20(S)-GRh2 on ALL cells. PI3K/Akt/mTOR pathway-related proteins were detected in 20(S)-GRh2-treated Jurkat cells by immunoblotting. Antitumor effect of 20(S)-GRh2 against T-ALL was investigated in xenograft mice. The mechanisms of 20(S)-GRh2 against T-ALL were examined by cell proliferation, apoptosis, and autophagy. Results: In the present study, the results showed that 20(S)-GRh2 decreased cell growth and arrested cell cycle at the G1 phase in ALL cells. 20(S)-GRh2 induced apoptosis through enhancing reactive oxygen species generation and upregulating apoptosis-related proteins. 20(S)-GRh2 significantly elevated the levels of pEGFP-LC3 and autophagy-related proteins in Jurkat cells. Furthermore, the PI3K/Akt/mTOR signaling pathway was effectively blocked by 20(S)-GRh2. 20(S)-GRh2 suppressed cell proliferation and promoted apoptosis and autophagy by suppressing the PI3K/Akt/mTOR pathway in Jurkat cells. Finally, 20(S)-GRh2 alleviated symptoms of leukemia and reduced the number of white blood cells and CD3 staining in the spleen of xenograft mice, indicating antitumor effects against T-ALL in vivo. Conclusion: These findings indicate that 20(S)-GRh2 exhibits beneficial effects against T-ALL through the PI3K/Akt/mTOR pathway and could be a natural product of novel target for T-ALL therapy.
Let E be a uniformly convex Banach space with a uniformly $G{\hat{a}}teaux$ differentiable norm, C a nonempty closed convex subset of E, and $T:C{\rightarrow}{\mathcal{K}}(E)$ a multivalued nonself-mapping such that $P_T$ is nonexpansive, where $P_T(x)=\{u_x{\in}Tx:{\parallel}x-u_x{\parallel}=d(x,Tx)\}$. For $f:C{\rightarrow}C$ a contraction and $t{\in}(0,1)$, let $x_t$ be a fixed point of a contraction $S_t:C{\rightarrow}{\mathcal{K}}(E)$, defined by $S_tx:=tP_T(x)+(1-t)f(x)$, $x{\in}C$. It is proved that if C is a nonexpansive retract of E and $\{x_t\}$ is bounded, then the strong ${\lim}_{t{\rightarrow}1}x_t$ exists and belongs to the fixed point set of T. Moreover, we study the strong convergence of $\{x_t\}$ with the weak inwardness condition on T in a reflexive Banach space with a uniformly $G{\hat{a}}teaux$ differentiable norm. Our results provide a partial answer to Jung's question.
Transactions of the Korean Society of Mechanical Engineers A
/
v.34
no.4
/
pp.457-465
/
2010
In this study, a Taylor series (T-S) model based on the Arrhenius, McVetty, and Monkman-Grant equations was developed using a mathematical analysis. In order to reduce fitting errors, the McVetty equation was transformed by considering the first three terms of the Taylor series equation. The model parameters were accurately determined by a statistical technique of maximum likelihood estimation, and this model was applied to the creep data of alloy 617. The T-S model results showed better agreement with the experimental data than other models such as the Eno, exponential, and L-M models. In particular, the T-S model was converted into an isothermal Taylor series (IT-S) model that can predict the creep strength at a given temperature. It was identified that the estimations obtained using the converted ITS model was better than that obtained using the T-S model for predicting the long-term creep life of alloy 617.
Genetic polymorphism of transferrin $(T_f)$ subtypes in Jeju population was studied by isoelectric focusing of human sera on polyacrylamide gels under high voltage, and haptolobin (Hp) polymorphism in Seoul and Jeju population was studied by polyacrylamide gel electrophoresis. Among 946 normal samples, three common types of transferrin, $T_{f}C_{1}, T_{f}C_{1}-C_{2} and T_{f}C_{2}$ were observed with some variants migrating slower than $T_{f}C$ subtypes, while among 139 patient (hepatitis) samples, only three common types were found. The gene frequencies were calculated as follows; in normal population, $T_{f}C^{1}$ was 0.7220; $T_{f}C^{2}, 0.2743; T_{f}D^{Jeju}, 0.0037$, and in patient population, $T_{f}C^{1} was 0.7194; T_{f}C^{2}, 0.2806$ respectively. Among 460 samples in Seoul and 502 in Jeju population, three types of haptoglobin, Hp 1-1, Hp 2-1 and Hp 2-2 were observed. The gene frequency of $Hp^1$ was 0.304, $Hp^2$, 0.696 in Seoul and in Jeju, $Hp^1$ was 0.269 and $Hp^2$, 0.731, respectively. The frequencies of the genes and the polymorphic phenotypes were discussed comparatively with the other populations.
Journal of the Korea Institute of Information Security & Cryptology
/
v.18
no.2
/
pp.3-10
/
2008
The choice of basis for representation of element in $GF(2^m)$ affects the efficiency of a multiplier. Among them, a multiplier using redundant representation efficiently supports trade-off between the area complexity and the time complexity since it can quickly carry out modular reduction. So time of a previous multiplier using redundant representation is faster than time of multiplier using others basis. But, the weakness of one has a upper space complexity compared to multiplier using others basis. In this paper, we propose a new efficient multiplier with consideration that polynomial exponentiation operations are frequently used in cryptographic hardwares. The proposed multiplier is suitable fer left-to-right exponentiation environment and provides efficiency between time and area complexity. And so, it has both time delay of $T_A+({\lceil}{\log}_2m{\rceil})T_x$ and area complexity of (2m-1)(m+s). As a result, the proposed multiplier reduces $2(ms+s^2)$ compared to the previous multiplier using equally-spaced polynomials in area complexity. In addition, it reduces $T_A+({\lceil}{\log}_2m+s{\rceil})T_x$ to $T_A+({\lceil}{\log}_2m{\rceil})T_x$ in the time complexity.($T_A$:Time delay of one AND gate, $T_x$:Time delay of one XOR gate, m:Degree of equally spaced irreducible polynomial, s:spacing factor)
TMS and tDCS are non-invasive devices that treat the diseases of patients or individual users, and manage or improve their health by applying stimulation to a brain through magnetism and electricity. The effect and safety of these devices have proved to be valid in several diseases, but research in this area is still much going on. Despite increasing cases of their application, legislations directly regulating TMS and tDCS are hard to find. Legal regulation regarding TMS and tDCS in the United States, Germany and Japan reveals that while TMS has been approved as a medical device with a moderate risk, tDCS has not yet earned approval as a medical device. However, the recent FDA guidance, European MDR changes, recalls in the US, and relevant legal provisions of Germany and Japan, as well as recommendations from expert groups all show signs of tDCS growing closer to getting approved as a medical device. Of course, safety and efficacy of tDCS can still be regulated as a general product instead of as a medical device. Considering multiple potential impacts on a human brain, however, the need for independent regulation is urgent. South Korea also lacks legal provisions explicitly regulating TMS and tDCS, but they fall into the category of the grade 3 medical devices according to the notifications of the Korean Ministry of Food and Drug Safety. And safety and efficacy of TMS are to be evaluated in compliance with the US FDA guidance. But no specific guidelines exist for tDCS yet. Given that tDCS devices are used in some hospitals in reality, and also at home by individual buyers, such a regulatory gap must quickly be addressed. In a longer term, legal system needs to be in place capable of independently regulating non-invasive brain stimulating devices.
Kim Hun;Cho Woo-Jin;Jeong Eun-Jeong;Ahn Jun-Suck;Lim Chi-Won;Yoo Young-Jae;Kim Kwang-Ho;Cha Yong-Jun
The Korean Journal of Food And Nutrition
/
v.17
no.4
/
pp.412-419
/
2004
In odor to select optimum extraction methods of volatile compounds in beef extract powder(BEP) as basic data for the development of a new detection method of irradiated BEP, four extraction methods, such as solid phase microextraction with polar fiber(S-PD) and non-polar fiber(S-CD), purge and trap(P&T) and liquid liquid continuous extraction(LLCE) methods, were tested with gas chromatography/mass spectrometry method. A total of 106 volatile compounds including 22 hydrocarbons, 7 aldehydes, 6 ketones, 13 alcohols, 6 sulfur-containing compounds, 19 nitrogen-containing compounds, 6 aromatic compounds, 17 terpenes, 8 furans and 2 miscellaneous compounds were detected in BEP by four detection methods. The most compounds(62 compounds) were detected by S-PD method, followed by P&T(43), LLCE(38) and S-CD method(30). Among these methods, S-PD and P&T methods showed a complementary interrelationship to detect volatile compounds as S-PD method showed high detectabiltiy to all compound groups except hydrocarbons and ketones, which had high volatility and low molecular weight(less than RI 1200), but P&T method showed the contrary pattern to that of S-PD method. Moreover, the most of volatile compounds detected by S-CD and LLCE methods were also detectable by S-PD or/and P&T methods. Therefore, the simultaneous application of S-PD and P&T methods were selected as the optimum volatile extraction methods of BEP.
In this study, to investigate the influence on the seam puckering by the mechanical properties of textiles, it was measured from 4 polyester/cotton samples. We reached the following conclusion in influences of the seam puckering by the thread, iron and laundry. Seam puckering is occurred several times by repeating the laundry. according to iron method, the seam puckering is stronger in order of T/C1> T/C2> T/C3> T/C4 by the samples and order of 40's/2> 60's/3> 50's/2> 60's/2 by the threads, the relation between sample's mechanical properties and seam strength and obtainment of formula. We can find that seam puckering is related with B, 2HB, G, 2HG5, RC, T among the mechanical properties and the estimated formulas which get from mechanical factors.
Proceedings of the Korean Society of Computer Information Conference
/
2021.01a
/
pp.313-316
/
2021
사물 인터넷 시스템에서 서버와 클라이언트의 신뢰성 확보는 매우 중요하다. 대부분의 IoT 시스템에서 신뢰성 확보를 위해 인증서 기법이 사용되고 있다. 인증서 기법을 사용하는 IoT 시스템은 데이터(인증서,공개키) 탈취 및 분실 취약점이 있다. 이러한 취약점을 강화하기 위해 서버와 클라이언트는 서로 주고받는 데이터의 무결성과 신뢰성을 보장할 수 있는 환경이 구축되어야 한다. 본 논문에서는 이러한 취약점을 보완하기 위하여 IPFS와 블록체인을 결합한 인증 강화 기법을 제시한다. 제시한 기법의 기본 개념은 IPFS를 이용하여 CA와 서버의 인증서와 공개키를 분산 저장하고, IPFS에 저장한 인증서와 공개키의 Content-Address를 블록체인에 보관한다. 마지막으로 제시한 기법의 타당성을 검토하기 위하여 Mobius, nCube, Ethereum, IPFS를 결합한 IoT 시스템을 구축하고 SSL을 사용한 인증 과정을 실험한다.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.