In this study, we report the development of a new dual reporter vector system for the analysis of promoter activity. This system employs green fluorescence emitting protein, EGFP, as a reporter, and uses red fluorescence emitting protein, DsRed, as a transfection control in a single vector. The expression of those two proteins can be readily detected via flow cytometry in a single analysis, with no need for any further manipulation after transfection. As this system allows for the simultaneous detection of both the control and reporter proteins in the same cells, only transfected cells which express the control protein, DsRed, can be subjected to promoter activity analysis, via the gating out of all un-transfected cells. This results in a dramatic increase in the promoter activity detection sensitivity. This novel reporter vector system should prove to be a simple and efficient method for the analysis of promoter activity.
The H1 histone family, member N, testis-specific (H1FNT) is exclusively expressed in the testis, and had its possible role for sperm chromatin formation. The purpose of this study is to investigate any genetic association of H1FNT gene with male infertility, especially at the promoter region. We examined the promoter single nucleotide polymorphisms (SNP) of H1FNT gene which is located within transcription factor binding site for its association with male infertility. The statistical analysis showed that the -1129A>T polymorphism was present at a statistically significance in male infertility (p=0.0059 and 0.0349 for hetero and risk type, respectively). The dual-luciferase promoter assay was performed to examine the polymorphic effect of this promoter SNP by the cloning of promoter region (1700bp fragment) into pGL3-basic vector. In our plasmid based reporter system, there is no big difference between wild and risk type. In conclusion, H1FNT -1129A>T promoter SNP is statistically significant with male infertility, especially with subfertile (non-azoospermia) group. Further analysis of its functional polymorphic effect in vivo may provide the biological significance of testis-specific histone with spermatogenesis.
To develop a convenient promoter analysis system for fungi, a null-pigment mutant (NPG) of Aspergillus nidulans was used with the 4'-phosphopantetheinyl transferase (PPTase) gene, npgA, which restores the normal pigmentation in A. nidulans, as a new reporter gene. The functional organization of serially deleted promoter regions of the A. nidulans trpC gene and the Cryphonectria parasitica crp gene in filamentous fungi was representatively investigated to establish a novel fungal promoter assay system that depends on color complementation of the NPG mutant with the PPTase npgA gene. Several promoter regions of the trpC and crp genes were fused to the npgA gene containing the 1,034-bp open reading frame and the 966-bp 3' downstream region from the TAA, and the constructed fusions were introduced into the NPG mutant in A. nidulans to evaluate color recovery due to the transcriptional activity of the sequence elements. Serial deletion of the trpC and crp promoter regions in this PPTase reporter assay system reaffirmed results in previous reports by using the fungal transformation step without a laborious verification process. This approach suggests a more rapid and convenient system than conventional analyses for fungal gene expression studies.
Background: The aim of the meta-analysis was to derive a more precise assessment of the association between p16 promoter methylation and thyroid cancer risk. Materials and Methods: The PubMed, Web of Science databases and Chinese CNKI were searched for relevant articles. Ultimately, seventeen case-control studies were included with a total of 804 thyroid cancer cases and 487 controls analysis by R Software (R version 3.1.2) including meta. Crude odds ratios with 95% confidence intervals were calculated using the random-effects model which were used to assess the strength of relationship between p16 methylation and lung carcinogenesis. Funnel plots were carried out to evaluate publication bias. Results: The meta-analysis results showed that the frequency of p16 promoter methylation in cancer tissue/blood was significantly higher than that normal tissue/blood (OR=5.46, 95%CI 3.12-9.55, P<0.0001) by random effects model with small heterogeneity. Conclusions: Thus, p16 promoter methylation may be associated with thyroid cancer risk.
식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.
Objective: Nanog, a homeodomain protein, has been investigated in humans and mice using embryonic stem cells (ESCs). Because of the limited availability of ESCs, few studies have reported the function and role of Nanog in porcine ESCs. Therefore, in this study, we investigated the location of the porcine Nanog chromosome and its basal promoter activity, which might have potential applications in development of ESCs specific marker as well as understanding its operating systems in the porcine. Methods: To characterize the porcine Nanog promoter, the 5'-flanking region of Nanog was isolated from cells of mini-pig ears. BLAST database search showed that there are two porcine Nanog genomic loci, chromosome 1 and 5, both of which contain an exon with a start codon. Deletion mutants from the 5'-flanking region of both loci were measured using the Dual-Luciferase Reporter Assay System, and a fluorescence marker, green fluorescence protein. Results: Promoter activity was detected in the sequences of chromosome 5, but not in those of chromosome 1. We identified the sequences from -99 to +194 that possessed promoter activity and contained transcription factor binding sites from deletion fragment analysis. Among the transcription factor binding sites, a Sp1 was found to play a crucial role in basal promoter activity, and point mutation of this site abolished its activity, confirming its role in promoter activity. Furthermore, gel shift analysis and chromatin immunoprecipitation analysis confirmed that Sp1 transcription factor binds to the Sp1 binding site in the porcine Nanog promoter. Taken together, these results show that Sp1 transcription factor is an essential element for porcine Nanog basal activity the same as in human and mouse. Conclusion: We showed that the porcine Nanog gene is located on porcine chromosome 5 and its basal transcriptional activity is controlled by Sp1 transcription factor.
Background: While qualitative analysis of methylation has been reviewed, the quantitative analysis of methylation has rarely been studied. We evaluated the methylation status of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions in non-small cell lung carcinomas (NSCLCs) by using pyrosequencing. Then, we evaluated the association between methylation at the promoter regions of these tumor suppressor genes and the clinicopathological parameters of the NSCLCs. Methods: We collected tumor tissues from a total of 53 patients with NSCLCs and analyzed the methylation level of the CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions by using pyrosequencing. In addition, we investigated the correlation between the hypermethylation of CDKN2A and the loss of $p16^{INK4A}$ immunoexpression. Results: Hypermethylation of CDKN2A, $RAR{\beta}$, and RASSF1A promoter regions were 16 (30.2%), 22 (41.5%), and 21 tumors (39.6%), respectively. The incidence of hypermethylation at the CDKN2A promoter in the tumors was higher in undifferentiated large cell carcinomas than in other subtypes (p=0.002). Hyperrmethylation of CDKN2A was significantly associated with $p16^{INK4A}$ immunoexpression loss (p=0.045). With regard to the clinicopathological characteristics of NSCLC, certain histopathological subtypes were found to be strongly associated with the loss of $p16^{INK4A}$ immunoexpression (p=0.016). Squamous cell carcinoma and undifferentiated large cell carcinoma showed $p16^{INK4A}$ immunoexpression loss more frequently. The Kaplan-Meier survival curves analysis showed that methylation level and patient survival were barely related to one another. Conclusion: We quantitatively analyzed the promoter methylation status by using pyrosequencing. We showed a significant correlation between CDKN2A hypermethylation and $p16^{INK4A}$ immunoexpression loss.
본 연구에서는 누에의 초기 배아시기에 유전자 발현 조절이 가능한 EEG-704 promoter를 개발하고자 하였다. Promoter의 핵심 영역을 결정하기 위하여, 10개의 서로 다른 partial mutant clone들을 만들고 이를 Sf9 곤충세포주에 도입하여 luciferase assay 방법을 사용하여 각각의 clone의 활성을 분석하였다. Constitutive promoter인 BmA3 promoter에 의한 활성과 비교하였을 때, 약 1.5 kb의 promoter 염기서열을 포함하는 clone이 가장 높은 luciferase 발현율을 나타내었다. 특히 EEG-704 유전자의 경우 BLAST를 이용한 유전자 비교 분석의 결과 누에의 열충격 단백질20.8 (BmHsp20.8) 과 동일한 것으로 밝혀졌으며, 정상 온도조건과 비교하였을 때 열충격을 가한 조건하에서 발현율이 증가하는 현상을 나타내었다. 특이적으로 발생단계에서 직 간접적으로 발현 조절이 가능한 이러한 promoter는 여러 유용 재조합 단백질 생산을 위한 형질전환 누에 개발 시 매우 유용할 것으로 생각된다.
B형간염바이러스(HBV)의 만성 감염은 간경화와 간세포암 발생 빈도를 현저히 높인다. HBV 감염의 임상적 결과는 숙주 유전적 요인과 바이러스의 유전자 변이, 그리고 환경적 요인 등에 결정된다. HBV 복제를 위한 HBV의 pre-genomic RNA 전사는 바이러스의 core promoter 활성화에 의해 조절된다. Core promoter 돌연변이는 급성간 질환과 간세포암 발생에 연관되어 있다. 본 연구팀은 미얀마의 HBV 감염 환자들로부터 바이러스 유전자를 획득하여 core promoter 부위의 유전자 변이들을 파악하였다. Core promoter의 상대적 유전자 활성 차이를 분석하기 위해서 core promoter를 luciferase reporter에 재조합한 시스템을 제작하였다. 분석한 core promoter의 유전자 변이들 중에서 C1731T와 G1806A 돌연변이가 HBV core promoter의 전사 활성화를 증가에 관여하였다. 돌연변이 부위를 중심으로 전사 인자들의 가능한 결합 부위 변화를 컴퓨터 프로그램 분석을 통해 조사한 결과, C/EBPβ와 XBP1 반응 부위가 새롭게 생성되었음을 도출하였다. C/EBPβ의 세포 내 발현은 C1713T 돌연변이를 가진 core promoter의 전사 활성을 증가시켰으며, XBP1 발현은 G1806A 돌연변이를 함유한 M95 promoter를 활성을 증가시켰다. HBV 감염의 치료는 약제 내성과 백신 회피 돌연변이 발생으로 문제점을 가지고 있는 상황에서, 이 연구 결과는 HBV core promoter 돌연변이의 분자생물학적 그리고 임상학적 중요성을 제공한다.
The promoter region flanking the 5’ CAZFP1 coding region was isolated from the genomic DNA of Capsicum annuum. To identify the upstream region of the CAZFP1 gene required for promoter activity, a series of CAZFP1 promoter deletion derivatives was created. Each deletion construct was analyzed by Agrobacterium-mediated transient transformation in tobacco leaves after infection by Pseudomonas syringae pv. tabaci, or treatment with methyl jasmonate (MeJA), ethylene, abscisic acid (ABA), salicylic acid (SA), cold and wounding. Promoter fragments of 685 bp or longer showed 7-fold or greater induction after P. s. pv. tabaci infection and MeJA treatment. The CAZFP1 full-length promoter (-999 bp) also showed 6-fold induction in response to ethylene. The transiently transformed tobacco leaves with the CAZFP1 full length promoter fused-GUS gene showed more than 5-fold induction in response to SA, ABA and cold. These results suggest that the CAZFP1 promoter contains responsive elements for pathogen, MeJA, ethylene, SA, ABA and cold.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.