• Design & Manufacturing
• /
• v.11 no.3
• /
• pp.35-40
• /
• 2017

PCR(Polymerase chain reaction) is a technique to replicate and amplify a desired part of DNA. It is used in various aspects such as DNA fingerprint analysis and rare DNA amplification of an extinct animal. Especially in the medical diagnosis field, it provides various measurement methods at the molecular level such as genetic diagnosis, and is a basic tool for molecular diagnostics. The internal shape of the plastic vial tube for PCR analysis used in the DNA detection process, and the surface roughness and internal cleanliness can affect detection and discrimination results. The plastic vial tube demanded by the developer of the PCR analysis equipment should be changed to a structure that eliminates the residual washing solution in the washing process to ensure the internal cleanliness. Thus the internal structure and the internal surface design for improving the PCR amplification efficiency are key issues to develop the plastic vial tube for the DNA detection process.

• Journal of Dairy Science and Biotechnology
• /
• v.38 no.4
• /
• pp.169-188
• /
• 2020

Salmonella spp. is the most common cause of gastrointestinal food poisoning worldwide, and human salmonellosis is mostly caused by the consumption of contaminated food. Therefore, the development of rapid detection methods for Salmoenlla spp. and rapid identification of the source of infection by subtyping are important for the surveillance and monitoring of food-borne salmonellosis. Therefore, this review introduces (1) History and nomenclature of Salmoenlla spp., (2) Epidemiology of Salmoenlla spp., (3) Detection methods for Salmoenlla spp. - conventional culture method, genetic detection method, molecular detection methods, and aptamer, and (4) Subtyping methods for Salmoenlla spp. - pulsed-field gel electrophoresis and repetitive sequence-based polymerase chain reaction (PCR).

• Journal of Sensor Science and Technology
• /
• v.30 no.6
• /
• pp.376-380
• /
• 2021

The accurate detection of hydrogen gas molecules is considered to be important for industrial safety. However, the selective detection of the gas using semiconductive metal oxides (SMOs)-based sensors is challenging. Here, we describe the fabrication of H₂ sensors in which a nanocellulose/graphene oxide (GO) hybrid membrane is attached to SnO₂ nanosheets (NSs). One-dimensional (1D) nanocellulose fibrils are attached to the surface of GO NSs (GONC membrane) by mixing GO and nanocellulose in a solution. The as-prepared GONC membrane is employed as a sacrificial template for SnO₂ NSs as well as a molecular sieving membrane for selective H₂ filtration. The combination of GONC membrane and SnO₂ NSs showed substantial selectivity to hydrogen gas (R_air / R_gas > 10 @ 0.8 % H₂, 100 ℃) with noise level responses to interfering gases (H₂S, CO, CH₃COCH₃, C₂H₅OH, and NO₂). These remarkable sensing results are attributed mainly to the molecular sieving effect of the GONC membrane. These results can facilitate the development of a highly selective H₂ detector using SMO sensors.

• BMB Reports
• /
• v.36 no.4
• /
• pp.399-402
• /
• 2003

Early detection of bladder cancer is particularly important since it dramatically affects the survival rates. However, neither urinary cytology nor tumor markers that are currently used are sensitive enough for the early detection of bladder cancer or recurrent disease. The ras genes are frequently mutated in cancer. In this study, we investigated the diagnostic potential of ras mutation analysis in urinary sediments of patients with bladder cancer using a single-strand conformation polymorphism analysis and polymerase chain reaction. Mutation in codon 12 of the H-ras gene was observed in 39% of the patients. Our results indicate that this approach may significantly improve diagnostic sensitivity in detecting bladder tumors.

• Journal of Microbiology and Biotechnology
• /
• v.23 no.7
• /
• pp.1041-1045
• /
• 2013

The xTAG$^{(R)}$ Gastrointestinal Pathogen Panel (GPP) is a multiplexed molecular test for 15 gastrointestinal pathogens. The sensitivity and specificity of this test were assessed in 901 stool specimens collected from pediatric and adult patients at four clinical sites. A combination of conventional and molecular methods was used as comparator. Sensitivity could be determined for 12 of 15 pathogens and was 94.3% overall. The specificity across all 15 targets was 98.5%. Testing for the pathogen identified was not requested by the physician in 65% of specimens. The simultaneous detection of these 15 pathogens can provide physicians with a more comprehensive assessment of the etiology of diarrheal disease.

• Analytical Science and Technology
• /
• v.20 no.3
• /
• pp.255-260
• /
• 2007

A new method for the simultaneous determination of low molecular weight amines and quaternary ammonium ions based on the separation by IC with a suppressor and the detection by MS with ESI has been developed. The method has been applied to the analysis of a mixture containing tetramethylammonium ion, tetraethylammonium ion, tetrapropylammonium ion, triethanolamine, trimethylamine and triethylamine. The constituents were separated by isocratic elution using an IonPac CS17 column, a cation-exchange column, and detected by conductivity and mass spectrometry. The newly developed method for the six components demonstrated that the repeatability in terms of relative standard deviation for three measurements was in the range of 0.1-0.5 %. The detection limits were between 0.2 and $0.9{\mu}g/mL$ by the IC/ESI-MS.

• Nuclear Engineering and Technology
• /
• v.56 no.3
• /
• pp.893-899
• /
• 2024

In a secondary cooling system of a sodium-cooled fast reactor (SFR), rapid detection of hydrogen due to sodium-water reaction (SWR) caused by water leakage from a heat exchanger tube of a steam generator (SG) is important in terms of safety and property protection of the SFR. For hydrogen detection, the hydrogen detectors using atomic transmission phenomenon of hydrogen within Ni-membrane were used in Japanese proto-type SFR "Monju". However, during the plant operation, detection signals of water leakage were observed even in the situation without SWR concerning temperature up and down in the cooling system. For this reason, the study of a new hydrogen detector has been carried out to improve stability, accuracy and reliability. In this research, the authors focus on the difference in composition of hydrogen and the difference between the background hydrogen under normal plant operation and the one generated by SWR and theoretically estimate the hydrogen behavior in liquid sodium by using ultra-accelerated quantum chemical molecular dynamics (UA-QCMD). Based on the estimation, dissolved H or NaH, rather than molecular hydrogen (H₂), is the predominant form of the background hydrogen in liquid sodium in terms of energetical stability. On the other hand, it was found that hydrogen molecules produced by the sodium-water reaction can exist stably as a form of a fine bubble concerning some confinement mechanism such as a NaH layer on their surface. At the same time, we observed experimentally that the fine H₂ bubbles exist stably in the liquid sodium, longer than previously expected. This paper describes the comparison between the theoretical estimation and experimental results based on hydrogen form in sodium in the development of the new hydrogen detector in Japan.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Molecules and Cells
• /
• v.19 no.2
• /
• pp.262-267
• /
• 2005

The capsaicinoid synthetase (CS) gene cosegregated perfectly with the C locus, which controls the presence of pungency, in 121 $F_2$ individuals from a cross between 'ECW123R' and 'CM334', both of Capsicum annuum. We concluded that CS and C are tightly linked. Sequence analysis of the genes of four pungent and four non-pungent pepper lines showed that the non-pungent peppers had a 2,529 bp-deletion in the 5' upstream region of CS. We have developed molecular markers of the C locus to detect pungency at the seedling stage. Based on the deleted sequence, we developed five SCAR markers, two of them being codominant. These SCAR markers will be useful for easy, accurate, and early detection of non-pungent individuals in breeding programs.

• Bulletin of the Korean Chemical Society
• /
• v.34 no.3
• /
• pp.723-724
• /
• 2013