• 농업과학연구
• /
• 제45권3호
• /
• pp.385-400
• /
• 2018

Marker-assisted backcrossing (MABC) is useful for selecting offspring with a highly recovered genetic background for a recurrent parent at early generation unlike rice and other field crops. Molecular marker sets applicable to practical MABC are scarce in vegetable crops including tomatoes. In this study, we used the National Center for Biotechnology Information- short read archive (NCBI-SRA) database that provided the whole genome sequences of 234 tomato accessions and selected 27,680 tag-single nucleotide polymorphisms (tag-SNPs) that can identify haplotypes in the tomato genome. From this SNP dataset, a total of 143 tag-SNPs that have a high polymorphism information content (PIC) value (> 0.3) and are physically evenly distributed on each chromosome were selected as a MABC marker set. This marker set was tested for its polymorphism in each pairwise cross combination constructed with 124 of the 234 tomato accessions, and a relatively high number of SNP markers polymorphic for the cross combination was observed. The reliability of the MABC SNP set was assessed by converting 18 SNPs into Luna probe-based high-resolution melting (HRM) markers and genotyping nine tomato accessions. The results show that the SNP information and HRM marker genotype matched in 98.6% of the experiment data points, indicating that our sequence analysis pipeline for SNP mining worked successfully. The tag-SNP set for the MABC developed in this study can be useful for not only a practical backcrossing program but also for cultivar identification and F1 seed purity test in tomatoes.

• 원예과학기술지
• /
• 제30권1호
• /
• pp.56-63
• /
• 2012

Tomato hypocotyl can generally be one of two colors, purple or green. Genetically, this trait is controlled by a single dominant gene. Hypocotyl tissue specific color expression is one of many visible genetic marker sources used to select tomato progeny. However, the visible marker does not show a clear distinction between homozygous genotype and heterozygous genotype from the breeding lines. Therefore, to identify a hypocotyl pigmentation related marker, we screened DNA polymorphisms in thirteen tomato lines showing purple or green hypocotyls. The markers used for screening consisted of primer set information obtained from anthocyanin related genes, conserved ortholog set II (COS II) marker sets localized near anthocyanin related genes, and restriction fragment length polymorphism (RFLP) markers localized near COS II markers, which produce polymorphisms between purple and green tomatoes. One primer from a RFLP fragment resulted in a polymorphism on agarose gel electrophoresis. From the RFLP fragment, a cleaved amplified polymorphic sequence (CAPS) marker was developed to distinguish between purple and green hypocotyls. The genotypes of 135 $F_2$ individuals were analyzed using the CAPS marker, and among them, 132 individuals corresponded to the phenotypes of hypocotyl pigmentation.

• 대한치과교정학회지
• /
• 제34권6호
• /
• pp.537-543
• /
• 2004

Microsatellite market는 유전연관분석을 위한 매우 유용한 유전표지이다. 그러나 대부분의 market들은 서양인의 정보를 이응하고 있으므로 다른 종족에서 사용할 때는 종족간에 존재할 수 있는 유전 변이의 현저한 차이를 검증해야 한다. 한국인과 일본인 집단에서 종족간 유전 변이를 조사하기 위하여, 각각 96명의 비 혈연관계의 한국인과 일본인 개체들에서 DNA를 채취하였다 그리고 microsatellite set(ABI PRISM Linkage Mapping Set- HDS, Applied Biosystems, Foster City, CA, USA)을 이용하여 1번 인간 염색체 전 부위에 걸쳐 51개의 microsatellite marker들을 배열하고 부착된 marker들의 위치를 분석하여 대립유전자 빈도와 이형질성을 결정하였다 그 결과, 한국인과 서양인 집단 사이에는 현저한 차이를 보였으나 한국인과 일본인 집단 사이에서는 매우 유사하였다. 본 연구의 결과는 유전 연관 연구에 앞서 일반적으로 상용되는 microsatellite marker에 관한 광범위한 검증을 반드시 시행하여야 한다는 것을 나타낸다. 또한 한국인과 일본인 집단 사이에서 유사하게 나타난 대립유전자 빈도와 이 형질성은 두 민족간의 동질성이 높다는 것을 의미하므로 두 민족을 대상으로 한 1번 인간염색체와 관련된 유전 질환의 유전 연관 연구를 시행할 때 동일한 microsatellite marker의 이용 가능성을 제시하였다.

• 한국언어정보학회지:언어와정보
• /
• 제16권2호
• /
• pp.43-66
• /
• 2012

In this paper, I attempt to define the semantics of cikum 'now' in Korean. To define it precisely, we need to look at how it interacts with different aspectual classes of verbs and with the semantics of tenses and aspects. In doing this we need to define the semantics of tenses and aspects. Here we run into the question of whether ess is a tense marker or an aspect marker. I assume that it is ambiguous. There are still cases where it is not clear whether ess is used as a tense marker or an aspect marker in an actual sentence. I discuss two such cases: one in which it is used with verbs like tochakha 'arrive' which have no salient resulting states, and one in which a state verb is used with cikum-kkaci 'until now'. The semantics of cikum can be defined differently depending on whether ess is a tense or an aspect. By discussing ko iss, which is an imperfect marker, I conclude that cikum means ${\lambda}P{\lambda}i[u{\subseteq}i{\wedge}P(i)]$, that is, a relation between a set of times which include an utterance time and a set of properties of times.

• Journal of Animal Science and Technology
• /
• 제52권2호
• /
• pp.91-96
• /
• 2010

본 연구는 돼지고기 원산지 식별에 활용될 수 있는 최적의 SNP marker set을 개발 및 확립하기 위해 수행되었다. 선발된 51개의 SNP marker들의 효율성, 다형성 및 독립성 검증을 실시하였으며 51개의 SNP marker set은 MassARRAY method에 의해서 Multiplex-PCR panel 4개로 디자인 되었으며, 농장별, 생산조합별, 모돈별, 웅돈별로 효과적으로 고유 유전자형 지문분석이 가능하게 제작되었고, 다른형태의 SNP 유전자형 분석 플랫폼에 적용될 수 있는 적절한 마커 갯수이다. 또한 51개의 SNP marker set을 적용하여 모의 실험 및 친자감별확율을 계산하였을 때 무작위 교배 집단(PI), 반형매 교배집단($PI_{half-sib}$)과 전형매 교배집단($PI_{sibs}$)을 통해 모의 실험을 한 결과 $5.63{\times}10^{-33}$, $4.35{\times}10^{-15}$ 그리고 $1.32{\times}10^{-15}$로 분석되었으며 친자확인률에서도 모두 100%에 가까운 확률값을 나타내었다. 따라서 본 연구에서 개발된 SNP marker set을 이용하여 돈육제품의 원산지를 추적에 이용한다면 개별돼지의 고유한 DNA 지문 정보를 생성할 뿐만 아니라, 이를 통하여 모돈과 웅돈을 식별하여 농장원산지를 확인이 가능 할 수 있을 것으로 사료된다. 따라서 국내산 돼지의 생산에서부터 돈육제품으로의 소비까지 이력추적이 가능한 도구로 제공 될 것이다.

• 대한가정학회지
• /
• 제48권2호
• /
• pp.85-94
• /
• 2010

Comparative analysis of marker efficiency in blouse patterns, based on different sleeve designs, was carried out. Sleeve designs used included set-in-sleeve, laglan sleeve, and epaulet sleeve. The two types of epaulet sleeves, A and B, are based on pattern arrangement methods of center back. Cloth and production conditions are the width of cloth, the number of marking pieces, and the direction for marking deployment. A blouse pattern saved to the PAD CAD System was graded with different sizes and arranged for industrial purpose to calculate the marker efficiency in different conditions. The results were as follows. On the whole, the marker efficiency of small pattern sized set-insleeve was higher than laglan and epaulet sleeve designs. It was also established that marker efficiency is dependent on cloth and production conditions. For small number of marking pieces, efficiency was higher in the condition of 110cm cloth widths compared with that condition of 150cm cloth widths. However the efficiency of large number of marking pieces was higher in the condition of 150cm cloth widths.

• 미생물학회지
• /
• 제39권1호
• /
• pp.40-44
• /
• 2003

탄저균은 그람양성 아포형성세균으로 탄저를 일으키는 원인균이다. Bacillus cereus그룹에 속하는 22종을 포함하여 Bacillus 속의 29종에서 탄저균을 검증할 수 있는 DNA 마커를 개발하고 이를 이용하여 B. cereus 그룹에서 탄저균만을 구분하였다. 한국산 탄저균 경주로부터 709 bp마커(KHTS)를 확보하였다. KHTS분절로부터 얻어진 internal primer set의 PCR 산물은 B. cereus 그룹의 다른 종으로부터 탄저균만을 구별하였다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국정보과학회 언어공학연구회:학술대회논문집(한글 및 한국어 정보처리)
• /
• 한국정보과학회언어공학연구회 2004년도 제16회 한글.언어.인지 한술대회
• /
• pp.323-328
• /
• 2004

The main concern of the paper is to establish a hypothesis in which the form thi is treated as a particular Contrastive Topic marker in Vietnamese sentence structure. We have investigated that the form thican be placed after a topical nominal or verbal to compose a Contrastive Topic phrase. Not only the subjects or objects but predicates in Vietnamese can have a CT interpretation with the marker thi. The thi-phrase not only refers to an entity or event the speaker wants to talk about, but also indicates that there exist contrastive alternatives the speaker wants to talk about. The nature of the contrastive topic decides the nature the alternative set and the choice of the topic of the implicated proposition. When the set of alternatives does not have the characteristic of scale, we have a descriptive opposite implicature. Again, if the contrastive set is a scalar set, we gat a denial-of expectation implicature.

• 한국농업기계학회:학술대회논문집
• /
• 한국농업기계학회 2005년도 동계 학술대회 논문집
• /
• pp.103-107
• /
• 2005