Park, GiRim;Jang, Hyun A;Jo, Sung-Hwan;Park, Younghoon;Oh, Sang-Keun;Nam, Moon
Korean Journal of Agricultural Science
/
v.45
no.3
/
pp.385-400
/
2018
Marker-assisted backcrossing (MABC) is useful for selecting offspring with a highly recovered genetic background for a recurrent parent at early generation unlike rice and other field crops. Molecular marker sets applicable to practical MABC are scarce in vegetable crops including tomatoes. In this study, we used the National Center for Biotechnology Information- short read archive (NCBI-SRA) database that provided the whole genome sequences of 234 tomato accessions and selected 27,680 tag-single nucleotide polymorphisms (tag-SNPs) that can identify haplotypes in the tomato genome. From this SNP dataset, a total of 143 tag-SNPs that have a high polymorphism information content (PIC) value (> 0.3) and are physically evenly distributed on each chromosome were selected as a MABC marker set. This marker set was tested for its polymorphism in each pairwise cross combination constructed with 124 of the 234 tomato accessions, and a relatively high number of SNP markers polymorphic for the cross combination was observed. The reliability of the MABC SNP set was assessed by converting 18 SNPs into Luna probe-based high-resolution melting (HRM) markers and genotyping nine tomato accessions. The results show that the SNP information and HRM marker genotype matched in 98.6% of the experiment data points, indicating that our sequence analysis pipeline for SNP mining worked successfully. The tag-SNP set for the MABC developed in this study can be useful for not only a practical backcrossing program but also for cultivar identification and F1 seed purity test in tomatoes.
Kim, Hyoun-Joung;Lee, Heung-Ryul;Hyun, Ji-Young;Won, Dong-Chan;Hong, Dong-Oh;Harn, Chee-Hark
Horticultural Science & Technology
/
v.30
no.1
/
pp.56-63
/
2012
Tomato hypocotyl can generally be one of two colors, purple or green. Genetically, this trait is controlled by a single dominant gene. Hypocotyl tissue specific color expression is one of many visible genetic marker sources used to select tomato progeny. However, the visible marker does not show a clear distinction between homozygous genotype and heterozygous genotype from the breeding lines. Therefore, to identify a hypocotyl pigmentation related marker, we screened DNA polymorphisms in thirteen tomato lines showing purple or green hypocotyls. The markers used for screening consisted of primer set information obtained from anthocyanin related genes, conserved ortholog set II (COS II) marker sets localized near anthocyanin related genes, and restriction fragment length polymorphism (RFLP) markers localized near COS II markers, which produce polymorphisms between purple and green tomatoes. One primer from a RFLP fragment resulted in a polymorphism on agarose gel electrophoresis. From the RFLP fragment, a cleaved amplified polymorphic sequence (CAPS) marker was developed to distinguish between purple and green hypocotyls. The genotypes of 135 $F_2$ individuals were analyzed using the CAPS marker, and among them, 132 individuals corresponded to the phenotypes of hypocotyl pigmentation.
Microsatellit markers are considered to be very promising genetic markers for genetic linkage analysis. The majority of the markers are as informative as in Caucasians but there are significant ethnic differences in the genetic variations. In order to investigate the genetic variations in the Korean and Japanese populations and their ethnic differences, 51 microsatellite marker loci spanning the whole human chromosome 1 were arranged from a commercially available set (ABI PRISM Linkage Mapping Set-HD5, Applied Biosystems, Foster City, CA, USA), and then determined the allelic frequencies and heterozygosities for these marker loci in the 90 unrelated Korean subjects and 90 unrelated Japanese subjects. Of all 51 markers tested, significant differences were observed when microsatellite allele frequency pattern of Korean was compared with those of Caucasian, while this pattern was highly similar between Korean and Japanese populations. Our data indicate that an extensive verification of public microsatellite markers in a particular population study should be undertaken prior to their linkage studies. Moreover, this information should facilitate genetic linkage studies of various hereditary diseases, especially in the Koreans and Japanese.
In this paper, I attempt to define the semantics of cikum 'now' in Korean. To define it precisely, we need to look at how it interacts with different aspectual classes of verbs and with the semantics of tenses and aspects. In doing this we need to define the semantics of tenses and aspects. Here we run into the question of whether ess is a tense marker or an aspect marker. I assume that it is ambiguous. There are still cases where it is not clear whether ess is used as a tense marker or an aspect marker in an actual sentence. I discuss two such cases: one in which it is used with verbs like tochakha 'arrive' which have no salient resulting states, and one in which a state verb is used with cikum-kkaci 'until now'. The semantics of cikum can be defined differently depending on whether ess is a tense or an aspect. By discussing ko iss, which is an imperfect marker, I conclude that cikum means ${\lambda}P{\lambda}i[u{\subseteq}i{\wedge}P(i)]$, that is, a relation between a set of times which include an utterance time and a set of properties of times.
Kim, Sang-Wook;Li, Xiaoping;Lee, Yun-Mi;Kim, Jong-Joo;Kim, Tae-Hun;Choi, Bong-Hwan;Kim, Kwan-Suk
Journal of Animal Science and Technology
/
v.52
no.2
/
pp.91-96
/
2010
The purpose of the study was to develop an optimum SNP marker set to be utilized for domestic pork traceability. The study tested 51 SNP markers analyzed for origin of farm to be determined from genotypes of offspring and parents in pigs. With the simulation data through random mating population (PI), half sib mating population ($PI_{half-sib}$) and full sib mating population ($PI_{sibs}$), probability of identical genotypes were analyzed as $5.63{\times}10^{-33}$, $4.35{\times}10^{-15}$ and $1.32{\times}10^{-15}$, respectively. The 51 SNP markers also had 100% accuracy for parental determination. These results suggest that if the pig breeding stock is genotyped with the 51 SNP markers, the genotype information of individual offspring can be checked for farm origins by tracing parental sow and sire. Therefore, these SNP markers will be useful to trace the pork from production to consumption in pigs.
Comparative analysis of marker efficiency in blouse patterns, based on different sleeve designs, was carried out. Sleeve designs used included set-in-sleeve, laglan sleeve, and epaulet sleeve. The two types of epaulet sleeves, A and B, are based on pattern arrangement methods of center back. Cloth and production conditions are the width of cloth, the number of marking pieces, and the direction for marking deployment. A blouse pattern saved to the PAD CAD System was graded with different sizes and arranged for industrial purpose to calculate the marker efficiency in different conditions. The results were as follows. On the whole, the marker efficiency of small pattern sized set-insleeve was higher than laglan and epaulet sleeve designs. It was also established that marker efficiency is dependent on cloth and production conditions. For small number of marking pieces, efficiency was higher in the condition of 110cm cloth widths compared with that condition of 150cm cloth widths. However the efficiency of large number of marking pieces was higher in the condition of 150cm cloth widths.
Bacillus anthracis is a gram-positive spore-forming bacterium that causes the disease anthrax. In order to develop a DNA marker specific for Bacillus anthracis and to discriminate this species from Bacillus cereus group, we applied the randomly amplified polymorphic DNA (RAPD)-PCR technique to a collection of 29 strains of the genus Bacillus, including 22 species of the B. cereus group. A 709-bp RAPD marker (KHT5) specific for B. anthracis was obtained from B. anthracis BAK. The PCR product of internal primer set from the KHT5 fragment distinguished B. anthracis from the other species of the B. cereus group.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Annual Conference on Human and Language Technology
/
2004.10d
/
pp.323-328
/
2004
The main concern of the paper is to establish a hypothesis in which the form thi is treated as a particular Contrastive Topic marker in Vietnamese sentence structure. We have investigated that the form thican be placed after a topical nominal or verbal to compose a Contrastive Topic phrase. Not only the subjects or objects but predicates in Vietnamese can have a CT interpretation with the marker thi. The thi-phrase not only refers to an entity or event the speaker wants to talk about, but also indicates that there exist contrastive alternatives the speaker wants to talk about. The nature of the contrastive topic decides the nature the alternative set and the choice of the topic of the implicated proposition. When the set of alternatives does not have the characteristic of scale, we have a descriptive opposite implicature. Again, if the contrastive set is a scalar set, we gat a denial-of expectation implicature.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.