Park, GiRim;Jang, Hyun A;Jo, Sung-Hwan;Park, Younghoon;Oh, Sang-Keun;Nam, Moon
농업과학연구
/
제45권3호
/
pp.385-400
/
2018
Marker-assisted backcrossing (MABC) is useful for selecting offspring with a highly recovered genetic background for a recurrent parent at early generation unlike rice and other field crops. Molecular marker sets applicable to practical MABC are scarce in vegetable crops including tomatoes. In this study, we used the National Center for Biotechnology Information- short read archive (NCBI-SRA) database that provided the whole genome sequences of 234 tomato accessions and selected 27,680 tag-single nucleotide polymorphisms (tag-SNPs) that can identify haplotypes in the tomato genome. From this SNP dataset, a total of 143 tag-SNPs that have a high polymorphism information content (PIC) value (> 0.3) and are physically evenly distributed on each chromosome were selected as a MABC marker set. This marker set was tested for its polymorphism in each pairwise cross combination constructed with 124 of the 234 tomato accessions, and a relatively high number of SNP markers polymorphic for the cross combination was observed. The reliability of the MABC SNP set was assessed by converting 18 SNPs into Luna probe-based high-resolution melting (HRM) markers and genotyping nine tomato accessions. The results show that the SNP information and HRM marker genotype matched in 98.6% of the experiment data points, indicating that our sequence analysis pipeline for SNP mining worked successfully. The tag-SNP set for the MABC developed in this study can be useful for not only a practical backcrossing program but also for cultivar identification and F1 seed purity test in tomatoes.
Kim, Hyoun-Joung;Lee, Heung-Ryul;Hyun, Ji-Young;Won, Dong-Chan;Hong, Dong-Oh;Harn, Chee-Hark
원예과학기술지
/
제30권1호
/
pp.56-63
/
2012
Tomato hypocotyl can generally be one of two colors, purple or green. Genetically, this trait is controlled by a single dominant gene. Hypocotyl tissue specific color expression is one of many visible genetic marker sources used to select tomato progeny. However, the visible marker does not show a clear distinction between homozygous genotype and heterozygous genotype from the breeding lines. Therefore, to identify a hypocotyl pigmentation related marker, we screened DNA polymorphisms in thirteen tomato lines showing purple or green hypocotyls. The markers used for screening consisted of primer set information obtained from anthocyanin related genes, conserved ortholog set II (COS II) marker sets localized near anthocyanin related genes, and restriction fragment length polymorphism (RFLP) markers localized near COS II markers, which produce polymorphisms between purple and green tomatoes. One primer from a RFLP fragment resulted in a polymorphism on agarose gel electrophoresis. From the RFLP fragment, a cleaved amplified polymorphic sequence (CAPS) marker was developed to distinguish between purple and green hypocotyls. The genotypes of 135 $F_2$ individuals were analyzed using the CAPS marker, and among them, 132 individuals corresponded to the phenotypes of hypocotyl pigmentation.
Microsatellite market는 유전연관분석을 위한 매우 유용한 유전표지이다. 그러나 대부분의 market들은 서양인의 정보를 이응하고 있으므로 다른 종족에서 사용할 때는 종족간에 존재할 수 있는 유전 변이의 현저한 차이를 검증해야 한다. 한국인과 일본인 집단에서 종족간 유전 변이를 조사하기 위하여, 각각 96명의 비 혈연관계의 한국인과 일본인 개체들에서 DNA를 채취하였다 그리고 microsatellite set(ABI PRISM Linkage Mapping Set- HDS, Applied Biosystems, Foster City, CA, USA)을 이용하여 1번 인간 염색체 전 부위에 걸쳐 51개의 microsatellite marker들을 배열하고 부착된 marker들의 위치를 분석하여 대립유전자 빈도와 이형질성을 결정하였다 그 결과, 한국인과 서양인 집단 사이에는 현저한 차이를 보였으나 한국인과 일본인 집단 사이에서는 매우 유사하였다. 본 연구의 결과는 유전 연관 연구에 앞서 일반적으로 상용되는 microsatellite marker에 관한 광범위한 검증을 반드시 시행하여야 한다는 것을 나타낸다. 또한 한국인과 일본인 집단 사이에서 유사하게 나타난 대립유전자 빈도와 이 형질성은 두 민족간의 동질성이 높다는 것을 의미하므로 두 민족을 대상으로 한 1번 인간염색체와 관련된 유전 질환의 유전 연관 연구를 시행할 때 동일한 microsatellite marker의 이용 가능성을 제시하였다.
In this paper, I attempt to define the semantics of cikum 'now' in Korean. To define it precisely, we need to look at how it interacts with different aspectual classes of verbs and with the semantics of tenses and aspects. In doing this we need to define the semantics of tenses and aspects. Here we run into the question of whether ess is a tense marker or an aspect marker. I assume that it is ambiguous. There are still cases where it is not clear whether ess is used as a tense marker or an aspect marker in an actual sentence. I discuss two such cases: one in which it is used with verbs like tochakha 'arrive' which have no salient resulting states, and one in which a state verb is used with cikum-kkaci 'until now'. The semantics of cikum can be defined differently depending on whether ess is a tense or an aspect. By discussing ko iss, which is an imperfect marker, I conclude that cikum means ${\lambda}P{\lambda}i[u{\subseteq}i{\wedge}P(i)]$, that is, a relation between a set of times which include an utterance time and a set of properties of times.
본 연구는 돼지고기 원산지 식별에 활용될 수 있는 최적의 SNP marker set을 개발 및 확립하기 위해 수행되었다. 선발된 51개의 SNP marker들의 효율성, 다형성 및 독립성 검증을 실시하였으며 51개의 SNP marker set은 MassARRAY method에 의해서 Multiplex-PCR panel 4개로 디자인 되었으며, 농장별, 생산조합별, 모돈별, 웅돈별로 효과적으로 고유 유전자형 지문분석이 가능하게 제작되었고, 다른형태의 SNP 유전자형 분석 플랫폼에 적용될 수 있는 적절한 마커 갯수이다. 또한 51개의 SNP marker set을 적용하여 모의 실험 및 친자감별확율을 계산하였을 때 무작위 교배 집단(PI), 반형매 교배집단($PI_{half-sib}$)과 전형매 교배집단($PI_{sibs}$)을 통해 모의 실험을 한 결과 $5.63{\times}10^{-33}$, $4.35{\times}10^{-15}$ 그리고 $1.32{\times}10^{-15}$로 분석되었으며 친자확인률에서도 모두 100%에 가까운 확률값을 나타내었다. 따라서 본 연구에서 개발된 SNP marker set을 이용하여 돈육제품의 원산지를 추적에 이용한다면 개별돼지의 고유한 DNA 지문 정보를 생성할 뿐만 아니라, 이를 통하여 모돈과 웅돈을 식별하여 농장원산지를 확인이 가능 할 수 있을 것으로 사료된다. 따라서 국내산 돼지의 생산에서부터 돈육제품으로의 소비까지 이력추적이 가능한 도구로 제공 될 것이다.
Comparative analysis of marker efficiency in blouse patterns, based on different sleeve designs, was carried out. Sleeve designs used included set-in-sleeve, laglan sleeve, and epaulet sleeve. The two types of epaulet sleeves, A and B, are based on pattern arrangement methods of center back. Cloth and production conditions are the width of cloth, the number of marking pieces, and the direction for marking deployment. A blouse pattern saved to the PAD CAD System was graded with different sizes and arranged for industrial purpose to calculate the marker efficiency in different conditions. The results were as follows. On the whole, the marker efficiency of small pattern sized set-insleeve was higher than laglan and epaulet sleeve designs. It was also established that marker efficiency is dependent on cloth and production conditions. For small number of marking pieces, efficiency was higher in the condition of 110cm cloth widths compared with that condition of 150cm cloth widths. However the efficiency of large number of marking pieces was higher in the condition of 150cm cloth widths.
탄저균은 그람양성 아포형성세균으로 탄저를 일으키는 원인균이다. Bacillus cereus그룹에 속하는 22종을 포함하여 Bacillus 속의 29종에서 탄저균을 검증할 수 있는 DNA 마커를 개발하고 이를 이용하여 B. cereus 그룹에서 탄저균만을 구분하였다. 한국산 탄저균 경주로부터 709 bp마커(KHTS)를 확보하였다. KHTS분절로부터 얻어진 internal primer set의 PCR 산물은 B. cereus 그룹의 다른 종으로부터 탄저균만을 구별하였다.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
The main concern of the paper is to establish a hypothesis in which the form thi is treated as a particular Contrastive Topic marker in Vietnamese sentence structure. We have investigated that the form thican be placed after a topical nominal or verbal to compose a Contrastive Topic phrase. Not only the subjects or objects but predicates in Vietnamese can have a CT interpretation with the marker thi. The thi-phrase not only refers to an entity or event the speaker wants to talk about, but also indicates that there exist contrastive alternatives the speaker wants to talk about. The nature of the contrastive topic decides the nature the alternative set and the choice of the topic of the implicated proposition. When the set of alternatives does not have the characteristic of scale, we have a descriptive opposite implicature. Again, if the contrastive set is a scalar set, we gat a denial-of expectation implicature.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.