• Journal of the Korean Society of Radiology
• /
• v.11 no.1
• /
• pp.49-54
• /
• 2017

As the Radiofrequency(RF) increases with the magnetic field strength, the wavelength of the RF excitation field becomes smaller, which leads to more the thermal effect in the human-body placed in the electric field. MRI scanner used was GE signa 1.5T, HDx 3.0T and Philips 3.0T with same routine clinical sequence protocol. Therefore temperature was measured before and after each scan. Taken the temperatures in the ear with ear infra-red type thermometer(Braun co). 3.0T were temperature increases more than $0.15^{\circ}C$ and GE 3.0T MRI equipment about $0.14^{\circ}C$ higher than the Philips 3.0T MRI(p<0.012). Psychogenic status was investigated by the survey respondents about their status can not just answer therefore, a little different from the expected. In our study of Thermal effect of clinical MRI with clinical protocol sequence, we found that the 3.0T in the body-temperature rise was greater than the 1.5T. Therefore, in clinical 3.0T examine the dangerous situation caused by the temperature rise occurred (burns, impaired thermoregulatory mechanism in patients with high-temperature damage, exhaustion occurs due to excessive sweating), not to appear the more watched the patient's condition with procedure.

• Korean Journal of Poultry Science
• /
• v.28 no.3
• /
• pp.275-281
• /
• 2001

The objective of this study was to investigate the effect of chitosan and green tea supplementation on laying performance and cholesterol concentrations of serum and egg yolk in laying hens. Total 360 laying hens were divided into four groups for feeding trials with three replication : control, T1 (0.15% chitosan), T2(0.15% green tea) and T3 (0.15% chitosan + 0.15% green tea) group. Feed intake was lower in control group (830g/week) than other treatment groups, but T2 of treatment group shows a tendency to decrease. The egg production and egg weight was significantly higher in T2 and T3 group than control. The cholesterol concentrations of serum with chitosan or green tea supplementation were significantly decreased after 8 week than starting trial, and especially those of T2 was lower than other treatment groups. The cholesterol concentrations of egg yolk were no effect of supplement with chitosan and green tea.

• Journal of Korean Society of Steel Construction
• /
• v.26 no.3
• /
• pp.231-240
• /
• 2014

The T-stub subjected to an axial tensile force shows various behavior characteristics according to the changes in the diameter and tightening force of the fastener, the geometric shape of the T-stub, and the material properties of the T-stub and fastener. Due to the influence of these changes, the T-stub shows three failure modes: plastic failure after the flexural yielding of the T-stub flange, flexural yielding of the T-stub fillet, and fracture of the fastener. In general, a T-stub with a thin flange and where the gauge distance of the fastener is long has a larger energy dissipation capacity than a T-stub with a thick flange and where the gauge distance of the fastener is short, due to the plastic deformation after flexural yielding. In this study, three-dimensional nonlinear finite element analysis was carried out to determine the effect of the fastener used for fastening the T-stub on the energy dissipation capacity of the T-stub. For the fastener of the T-stub analysis model, F10T-M20 high-tension bolts and ${\varnothing}19.05-mm$ (3/4-inch) SMA bars were modeled, and the geometric shape of the T-stub was selected to represent the flexural yielding of the T-stub fillet and the axial tensile failure of the fastener.

• Korean Journal of Anesthesiology
• /
• v.71 no.6
• /
• pp.459-466
• /
• 2018

Background: To compare the effects of intraoperative infusions of balanced electrolyte solution (BES)-based hydroxyethyl starch (HES) and saline-based albumin on metabolic acidosis and acid/base changes during major abdominal surgery conducted using Stewart's approach. Methods: Forty patients, aged 20-65 years, undergoing major abdominal surgery, were randomly assigned to the HES group (n = 20; received 500 ml of BES-based 6% HES 130/0.4) or the albumin group (n = 20; received 500 ml of normal saline-based 5% albumin). Acid-base parameters were measured and calculated using results obtained from arterial blood samples taken after anesthesia induction (T1), 2 hours after surgery commencement (T2), immediately after surgery (T3), and 1 hour after arriving at a postanesthetic care unit (T4). Results: Arterial pH in the HES group was significantly higher than that in the albumin group at T3 ($7.40{\pm}0.04$ vs. $7.38{\pm}0.04$, P = 0.043), and pH values exhibited significant intergroup difference over time (P = 0.002). Arterial pH was significantly lower at T3 and T4 in the HES group and at T2, T3, and T4 in the albumin group than at T1. Apparent strong ion difference (SIDa) was significantly lower at T2, T3, and T4 than at T1 in both groups. Total plasma weak nonvolatile acid ($A_{TOT}$) was significantly lower in the HES group than in the albumin group at T2, T3 and T4 and exhibited a significant intergroup difference over time (P < 0.001). Conclusions: BES-based 6% HES infusion was associated with lower arterial pH values at the end of surgery than saline-based 5% albumin infusion, but neither colloid caused clinically significant metabolic acidosis (defined as an arterial pH < 7.35).

• Applied Biological Chemistry
• /
• v.45 no.1
• /
• pp.47-52
• /
• 2002

In order to search for insulin-like substances from the constituted herbs of Sogal prescriptions, we selected 19 traditional herbs, based on a review of the Donguibogam. The effects of the hot-water extract from the selected herbs on the proliferation and the differentiation of 3T3-L1 fibroblasts were tested. The various water-extracts from Pinellia ternata, Magnolia obovata, Rheum palmatum, Acanthopanax sessiliflorun, Atractylodes japonica and Strychnos ignatii inhibited the proliferation of 3T3-L1 fibroblasts, did not influence entirely in differentiation of 3T3-L1 fibroblasts. Treatment of 3T3-L1 fibroblasts with the extract from Ephedra sinica, Trichosanthes kirilowii, Scrophularia buergeriana and Sophora flavescens significantly increased the differentiation of the cells. In conclusion, these may contain such compounds that play a role of insulin-like action.

• Journal of Animal Science and Technology
• /
• v.53 no.4
• /
• pp.367-375
• /
• 2011

This study was carried out to investigate the effects of the level of cracked whole barley on daily feed intake, daily body weight gain, carcass characteristics and meat composition of finishing Hanwoo steers (feeding from 24 months to 30 months of age). The dietary treatments were consisted of five types (C; normal concentrate as a basal diet, T1; 10% addition of cracked whole barley, T2; 20% addition of cracked whole barley, T3; 30% addition of cracked whole barley, T4; 40% addition of cracked whole barley). A total 30 Hanwoo steers (588.6${\pm}$11.8kg) were allocated to 5 feeding groups. The daily feed intake and daily body weight gain were high in the order of T2 > T3 >T4 > T1 > C. The back fat thickness and longissmus muscle area were highest in C and T1, respectively (P<0.05) than other treatments. The meat yield index decreased with increased back fat thickness. The marbling score and meat quality were highest in T1 (P<0.01, 0.05, respectively), but maturity, fat color and meat color were not significantly different among treatments. The crude fat was highest in T1 (17.59%), while in T4 (7.47%) it was lowest (P<0.05). The crude protein and crude ash were not significantly different among treatments. The energy value of cracked whole barley treatments (T1, T2, T3, T4) was higher than C (P<0.05). The contents of Ca, Cu, K, Mg, Mo, Na and Zn were higher in C than the other treatments (P<0.01), but Co was higher in T2 (P<0.01). The CIE $L^*$ value of whole cracked barley treatments (T1, T2, T3, T4) was higher than C, however there were not differences among the treatments. The CIE $a^*$ value was highest in T1(P<0.05) than others. The CIE $b^*$ value was highest in C and it was decreased with increased feeding of cracked whole barley. Based on the above results, T1 treatment compared to other treatments improved the carcass quality parameters like loin muscle area, marbling score, meat quality, and CIE $L^*$ value.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• The Korean Journal of Nuclear Medicine
• /
• v.16 no.1
• /
• pp.7-14
• /
• 1982

In an attempt to evaluate the various serum hormonal changes in terminal renal failure, the fasting $T_4,\;T_3,\;rT_3$, gastrin, secretin prolactin, and aldosterone were measured by radioimmunoassay in 12 patients with chronic renal failure, who were admitted to Chosun University Hospital from January to June, 1981. From the analysis the following results were obtained. 1. Mean values of serum hormonal concentration in 10 normal control were as follows: $T_4,\;12.93{\pm}2.00ug/ml$; $T_3,\;113.0{\pm}28.7ng/ml$; $rT_3,\;0.11{\pm}0.10ng/ml$; gastrin, $100.0{\pm}47.1pg/ml$; secretin, $32.46{\pm}11.45pg/ml$; prolactin, $11.0{\pm}3.6ng/ml$; aldosterone, $137.0{\pm}58.5pg/ml$, 2. Mean values of serum hormonal concentration in 12 chronic renal failure were as follows: $T_4,\;7.34{\pm}2.43ug/ml$; $T_3,\;71.0{\pm}19.1ng/ml$; reverse $T_3,\;0.38{\pm}0.19ng/ml$; gastrin, $162.5{\pm}40.2pg/ml$; secretin, $107.50{\pm}20.48pg/ml$; prolactin, $34.0{\pm}17.2ng/ml$; Aldosterone, $86.5{\pm}19.8pg/ml$. 3. In chronic renal failure group, serum T 4, T 3 and adosterone level were significantly lower than those of the control group, but serum $rT_3$, gastrin, secretin and prolactin were significantly higher than those of the control group. 4. In the view of the correlation between serum hormonal concentions and serum creatinine levels in patients with chronic renal failure, $rT_3$, gastrin, secretin and prolactin showed increasing tendency(positive correlations), whereas $T_4,\;T_3$ and aldosterone showed decreasing tendency (negative correlations) with increment of serum cteatinine levels. And so, we observed the negative correlation between $T_3\;and\;rT_3$.

• Journal of Life Science
• /
• v.21 no.1
• /
• pp.74-80
• /
• 2011

This study was carried out to investigate the effects of the addition of red wine on the quality characteristics and free amino acid content of seasoned pork meat. Seasoned pork meat was prepared using three variation: pork meat containing 25% water (T0), pork meat containing a combination of 20% water and 5% red wine (T1), pork meat containing a combination of 15% water and 10% red wine (T2), and pork meat containing a combination of 10% water and 15% red wine (T3). There were no significant differences in moisture, crude protein, crude fat, crude ash, a* value, rheological properties, pH, VBN content, saturated fatty acid or unsaturated fatty acid among T0, T1, T2 and T3. The L* and b* value of seasoned pork meat was higher in T2 and T3 than in T0 and T1 (p<0.05). The TBARS value was highest in T0 (p<0.05). The free amino acid content was higher in T2 and T3 than in T0 (p<0.05).

• Journal of the Korean Magnetics Society
• /
• v.26 no.3
• /
• pp.105-114
• /
• 2016

In this study, For assessment of triangular fibrocartilage complex (TFCC) injury, we acquired images by fat suppressed 3D fast spoiled gradient recalled T1 and fat suppressed Isotropic 3D fast spin echo T1 techniques. For quantitative evaluation, measured signal to noise ratio and contrast to noise ratio and verified statistical significance between two imaging techniques by Mann-Whitney U verification. And for qualitative evaluation, marked 4-grade scoring (0: non diagnostic, 1: poor, 2: adequate, 3: good) on shape of TFCC, artifacts by partial volumes, description of the lesions by two radiologist, verified coincidence between 2 observer using Kappa-value verification. We used 3.0 Tesla MR equipment and 8-channel RF coil for imaging acquisition. As quantitative evaluation results, signal to noise ratio and contrast to noise ratio value of Isotropic 3D fast spin echo T1 technique is higher in every image sections, also between two imaging techniques by Mann-Whitney U verification was statistically significant (p < 0.05). As qualitative results, observer 1, 2 marked a higher grade on Isotropic 3D FSE T1 technique, coincidence verification of evaluation results between two observers by Kappa-value verification was statistically significant (p < 0.05). As a result, during MRI examination on TFCC injury, fat suppressed Isotropic 3D fast spin echo T1 technique is considered offering more useful information about abnormal lesion of TFCC.