Construction and Immunogenicity of Recombinant Swinepox Virus Expressing Outer Membrane Protein L of Salmonella

Abstract

Salmonella spp. are gram-negative flagellated bacteria that cause a variety of diseases in humans and animals, ranging from mild gastroenteritis to severe systemic infection. To explore development of a potent vaccine against Salmonella infections, the gene encoding outer membrane protein L (ompL) was inserted into the swinepox virus (SPV) genome by homologous recombination. PCR, western blot, and immunofluorescence assays were used to verify the recombinant swinepox virus rSPV-OmpL. The immune responses and protection efficacy of rSPV-OmpL were assessed in a mouse model. Forty mice were assigned to four groups, which were immunized with rSPV-OmpL, inactive Salmonella (positive control), wild-type SPV (wtSPV; negative control), or PBS (challenge control), respectively. The OmpL-specific antibody in the rSPV-OmpL-immunized group increased dramatically and continuously over time post-vaccination, and was present at a significantly higher level than in the positive control group (p < 0.05). The concentrations of IFN-γ and IL-4, which represent Th1-type and Th2-type cytokine responses, were significantly higher (p < 0.05) in the rSPV-OmpL-vaccinated group than in the other three groups. After intraperitoneal challenge with a lethal dose of Salmonella typhimurium CVCC542, eight out of ten mice in the rSPV-OmpL-vaccinated group were protected, whereas all the mice in the negative control and challenge control groups died within 3 days. Passive immune protection assays showed that hyperimmune sera against OmpL could provide mice with effective protection against challenge from S. typhimurium. The recombinant swinepox virus rSPV-OmpL might serve as a promising vaccine against Salmonella infection.

Introduction

Salmonella spp. are gram-negative flagellated bacteria that include several very important serovars, including Typhi, Paratyphi, Typhimurium, Enteritidis, and Choleraesuis. These bacteria cause a significant global burden of zoonosis, typically classified into enteric fever, gastroenteritis, and, more recently, invasive non-typhoidal salmonellosis (iNTS) [26,27,35]. Epidemics of Salmonella infection cause great losses in animal production and are the main source of human food-borne diarrheal illness [15]. Antibiotics such as ampicillin, chloramphenicol and streptomycin are widely applied in the treatment of salmonellosis. However, as in many other bacteria, multidrug resistance of Salmonella is increasingly common and is a worldwide public health and economic problem. Multidrug-resistant strains of Salmonella can pass to humans through the food chain via animals, posing a threat to human health and leading to human antibiotic resistance [19]. Vaccination is an effective and economic measure to prevent some infectious diseases and can effectively avoid multidrug resistance [1,12,23]. Therefore, it is necessary to develop a potent Salmonella vaccine to protect public health and safety, as well as healthy animal production.

The outer membrane proteins (OMPs) of Salmonella contain a family of pore-forming proteins called porins [28]. OMPs are immunologically important because of their accessibility to the host defense system [33]. Several Salmonella OMPs have been considered as potential candidates for conferring protection against Salmonella infection [9,11,20]. Outer membrane protein L (OmpL) is a transmembrane β-barrel protein of 230 amino acid residues, which has been proven to be an effective protective antigen against Salmonella infection [34]. Owing to their strong induction of immunity and large capacity for heterogeneous DNA insertion, pox viruses have attracted widespread attention as live virus carriers of human and animal vaccines, and are technologically suitable for the development of recombinant vaccines [8,10,21]. Swinepox virus (SPV) is known to infect porcine species only and manifests slight clinical symptoms with occasional localized skin lesions that heal naturally [17]. Therefore, SPV has excellent features as a potential vaccine vector.

In this study, we constructed a recombinant SPV expressing Salmonella OmpL and characterized the replication and OmpL expression of the virus in PK-15 cells. In a variety of mouse trials, the recombinant swinepox virus (rSPV)-OmpL was proven to be a potential candidate vaccine against Salmonella infection.

 

Materials and Methods

Cells and Viruses

Porcine kidney PK-15 cells (CCL-33) and SPV (VR-363) used in this study were purchased from the American Type Culture Collection (ATCC). The cells were routinely cultured at 37℃ in 5% CO2 in Eagle’s Minimum Essential Medium, supplemented with 10% fetal bovine serum.

Animals and Housing

Two hundred and fifty 4-week-old female ICR mice were purchased from the Comparative Medicine Center of Yangzhou University. They were randomly divided into 25 groups. All experimental protocols involving mice were approved by the Laboratory Animal Monitoring Committee of Jiangsu Province and performed accordingly.

Construction and Identification of the Recombinant Swinepox Virus

The 633 bp ompL gene (NCBI Reference Sequence: NP_462896.1) was amplified from the Salmonella typhimurium CVCC542 genome using primers OmpL-F (5’-3’: CAGGTCGACGGCGCTTATGTAGAAAACC) and OmpL-R (5’-3’: CTAGGATCCTCAGAAGAAATACTTCGCCC), and then inserted into the pUSG11/P28 plasmid to create the transfer vector pUSG11/P28OmpL (Fig. 1) [14]. The recombinant swinepox virus rSPV-OmpL was constructed by homologous recombination of wild-type SPV with pUSG11/ P28OmpL as previously described [14]. Briefly, PK-15 cells grown in a 6-well plate were infected with the SPV (moi of 0.05) for 1 h, and subsequently transfected with 4.0 μg of t he p USG11/ P28OmpL plasmid using Exfect Transfection Reagent (Vazyme Biotech Co., Ltd.). After 72 h, PK-15 cells were harvested and lysed by two rounds of freezing and thawing. The lysate was used to infect PK-15 cells grown in a 12-well plate for further purification of recombinant viruses. Then 1.5 ml of medium with 1% LMP agarose (TaKaRa) was added to each well and incubation was continued for 6 days until green fluorescence became visible. Recombinant viruses with green fluorescence was picked under a fluorescent microscope, resuspended in 0.4 ml of medium, and lysed by two rounds of freezing and thawing. Plaque isolation was repeated for 8-9 rounds until all plaques in a given well were of green fluorescence. The recombinant SPV bearing OmpL of Salmonella was designated as rSPV-OmpL. The ompL gene and the expression of OmpL protein were analyzed by PCR, western blotting, and indirect immunofluorescence. Polyclonal antibody of recombinant OmpL was used as the primary antibody in western blotting and indirect immunofluorescence. Recombinant OmpL was expressed in Escherichia coli BL21 (DE3), purified by affinity chromatography, and utilized to raise polyclonal antibody in rabbit. The replication capacity and genetic stability of rSPV-OmpL were also evaluated as previously described [13].

Fig. 1.The transfer plasmid pUSG11/P28O. LF and RF indicate left flanking sequences and right flanking sequences of swinepox virus, respectively. P11 and P28 are vaccinia virus promoters. The GFP reporter gene is also included in the plasmid. The ompL gene is the gene for the protective antigen against Salmonella.

Immunogenicity of rSPV-OmpL

Forty 4-week-old female ICR mice were randomly and equally assigned t o four g roup s. M ice in g roup 1 w ere immunized intramuscularly with 4 × 107 plaque forming units of rSPV-OmpL (0.2 ml); mice in group 2 were immunized intramuscularly with 4 × 107 plaque forming units of wild-type SPV (0.2 ml) as negative controls; and mice in group 3 were immunized with 4 × 106 colony forming units (0.2 ml) of inactive Salmonella as positive controls. The inactive Salmonella was produced by adding 0.8% formaldehyde into S. typhimurium culture in log phase (OD600 = 0.6) for about 24 h at 37℃, which was then centrifuged at 10,000 ×g for 1 min and washed three times with PBS. The inactive Salmonella was mixed equally with Freund’s complete adjuvant. Two booster inoculations were given to the above three groups at biweekly intervals. Group 4 was the challenge control (treated with PBS). Two weeks after the last booster dose, all mice were challenged intraperitoneally with 0.2 ml of S. typhimurium CVCC542 (2 × 106 colony forming units; approximately 5× LD50) of log phase bacteria (OD600 = 0.6). Signs of Salmonella infection (rough hair, diarrhea, decreased mobility or ataxia) and lethality were recorded daily for 10 days and animals showing signs of irreversible illness were humanely euthanized with 100% CO2. The spleen and liver of dead animals were cultured to verify whether Salmonella was the cause of death. Experiments were repeated twice, with a total of 20 mice per group.

Specific Antibody Titers

Forty 4-week-old female ICR mice were randomly and equally assigned to four groups; all groups of mice (groups 1 to 4) were treated as described in the section above. Blood was obtained for serum preparation on days 0, 7, 14, 21, 28, and 35. Two mice from each group were sampled on each date. Ten mice in each group were sampled in rotation to minimize the stress of blood loss. The sera were stored at −20℃. At the end of this process, all mice were humanely euthanized with 100% CO2. ELISA plates (96-well; Corning) were coated with 0.2 μg of purified prokaryotic expression product of recombinant OmpL in 100 μl of 50 mM sodium carbonate buffer (pH 9.6) and incubated overnight at 4℃. The coated plates were washed three times with PBST and blocked with 5% skimmed milk in PBST at 37℃ for 2 h. The plates were washed three times with PBST. The sera were serially diluted by 2-fold (from 1:10 to 1:81,920), added to the wells and incubated for 1 h at 37℃. The negative control (serum obtained from mice in the challenge control group) and the blank control (without sera) were set up at the same time. After three washes, 100 μl of horseradish-peroxidase-conjugated goat anti-mouse IgG (diluted 1:10,000 in PBST) was added to each well, and the plates were incubated at room temperature in the dark for 30 min. After incubation, the plates were washed three times. The reaction products were developed using the TMB microwell peroxidase (Tiangen; Beijing, China) substrate system for 20 min, and s top ped w ith 100 μl of 2.0 M sulfuric acid per well. All assays were performed in duplicate. Reactions were measured using a Bio-Rad microplate reader at an absorbance of 450 nm.

The mean absorbance values for each set of duplicate samples were calculated. The S/N value of the ELISA results from each serum sample was calculated. The S/N value was [Abssample − Absblank control]/[Absnegative control − Absblank control]. Sera with the S/N value >2.1 were considered to be positive. The antibody titers are expressed as the highest dilution of antibody producing 2.1 ratio values. Experiments were repeated twice, with a total of 20 mice per group.

Cytokine Assay

The levels of serum IFN-γ and IL-4 induced by rSPV-OmpL were investigated to evaluate the cellular immune response. Immune responses are mainly evoked by Th1 and Th2 T-cell subgroups. Th1 cells, which produce IFN-γ, IL-2, and TNF-β, evoke cell-mediated immunity and phagocyte-dependent inflammation. Th2 cells, which produce IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13, evoke strong antibody responses and eosinophil accumulation. The immune response type was assessed indirectly by measuring the levels of IFN-γ and IL-4 in the serum. They were detected using ELISA kits (ExCell Bio) according to the manufacturer’s instructions. Standard curves were generated using control IFN-γ and IL-4 serially diluted 2-fold in PBS and coated onto ELISA plates overnight at 37℃. The levels of serum IFN-γ and IL-4 were calculated according to the corresponding standard curves.

Passive Immune Protection Assays

Passive protection tests were performed as previously described [5]. Briefly, forty 4-week-old female ICR mice were randomly and equally assigned to four groups. Mice in group 1 were passively immunized with 200 μl of hyperimmune sera derived from rSPV-OmpL- immunized mice (antibody titer of 9.25 × 104) by i.v.; mice in group 2 were passively immunized with 200 μl of hyperimmune sera against Salmonella inactive vaccine (antibody titer of 1.02 × 105) by i.v. as the positive control; mice in group 3 were passively immunized with control sera obtained from Salmonella antibody-negative mice as the negative control; group 4 was treated with PBS as the challenge control. In the 24 h after immunization, all mice were challenged intraperitoneally with 0.2 ml (2 × 106 colony forming units; 5× LD50) of S. typhimurium CVCC542. Signs of Salmonella infection and lethality were recorded daily for 10 days and animals showing signs of irreversible illnesses were humanely euthanized with 100% CO2. Experiments were repeated twice, with a total of 20 mice per group.

Statistical Analysis

All data were analyzed using one-way ANOVA. A p value <0.05 was considered statistically significant.

 

Results

Construction of the Transfer Plasmid

The transfer plasmid pUSG11/P28O, which includes the SPV flanking sequences, the modified promoter P28 with the downstream ompL gene, and the P11-GFP gene expression cassette, was constructed to generate the recombinant SPV (Fig. 1). The gene ompL was inserted into the SPV genome by homologous recombination and the recombinant SPV was screened using the GFP reporter.

Characterization of the Recombinant Swinepox Virus

An approximately 633 bp ompL gene fragment was amplified by using specific ompL primers and was present in the recombinant virus but not in wild-type (wt) SPV (Fig. 2A). Western blot analysis using polyclonal antibody of recombinant OmpL as the primary antibody showed a specific protein band of 28 kDa in the cell lysates infected with rSPV-OmpL, in accordance with the predicted size of the Salmonella OmpL protein (Fig. 2B). In the indirect immunofluorescence assays, which using polyclonal antibody of recombinant OmpL as the primary antibody, significant red fluorescence was observed in rSPV-OmpL-infected PK-15 cells (Fig. 2C), whereas no specific red fluorescence was detected in wtSPV-infected PK-15 cells (Fig. 2D). Therefore, we conclude that the rSPV-OmpL virus was generated and efficiently expressed Salmonella OmpL.

Fig. 2.Characterization of recombinant swinepox virus. (A) PCR analysis of the recombinant virus rSPV-OmpL. Lane 1: DL5000 DNA marker; Lane2: rSPV-OmpL A 633 bp fragment of ompL was amplified with specific primers. Lane 3: wtSPV. (B) Western blot analysis with polyclonal antibody of recombinant OmpL as primary antibody. Lane 1: Prestained protein marker; Lane 2: extract of PK-15 cells containing rSPV-OmpL; Lane 3: extract of cells containing wild-type SPV. (C, D) Identification of the expression of rSPV-OmpL by IFA with polyclonal antibody of recombinant OmpL as primary antibody. (C) PK-15 cells containing rSPV-OmpL. (D) PK-15 cells containing wild-type SPV.

rSPV-OmpL Induces Specific Antibody Response in Mice

The OmpL-specific antibody response elicited after immunization with rSPV-OmpL was monitored by detecting the serum antibody titers in mice. From 7 days post-vaccination, the OmpL-specific antibody titers increased dramatically and reached a peak after the third vaccination (35 days post the initial vaccination). The OmpL-specific antibody titers of mice vaccinated with inactive Salmonella were significantly lower at all time points post-vaccination than those of mice vaccinated with rSPV-OmpL (p < 0.05) (Fig. 3).

Fig. 3.OmpL-specific antibody responses following vaccination. Logarithm of antibody titer is plotted against days post-vaccination. The antibody titers of the rSPV-OmpL-vaccinated mice were significantly higher at all time points post-vaccination than those of wtSPV or PBS treated mice (p < 0.01). The antibody titers of mice vaccinated with inactive Salmonella were significantly lower (p < 0.05) at all time points post-vaccination than those of mice vaccinated with rSPV-OmpL.

rSPV-OmpL Induces Th1-Type and Th2-Type Cytokine Responses in Mice

Changes in serum IL-4 and IFN-γ levels in immunized mice were analyzed using ELISA kits. The concentrations of IL-4 and IFN-γ in the rSPV-OmpL group were significantly higher than those in the control groups at all post-infection time points (p < 0.05) (Figs. 4 and 5). These results suggest that rSPV-OmpL elicits potent Th1-type and Th2-type cytokine responses in mice.

Fig. 4.The concentration of serum IL-4. The concentration in the rSPV-OmpL group was significantly higher (p < 0.05) than those in the inactive Salmonella-treated group, wtSPV group, and PBS group at all time points post-infection.

Fig. 5.The concentration of serum IFN-γ. The concentration in the rSPV-OmpL group was significantly higher (p < 0.05) than those in the other control groups at 7, 14, 21, and 28d ays post-infection. At 35 days post-infection, the level in the rSPV-OmpL group was very significantly higher (p < 0.01) than those in the other groups.

rSPV-OmpL Mediates Immunoprotection against Salmonella Lethal Challenge

After challenge with a lethal dose of S. typhimurium CVCC542, all mice in the wtSPV group (negative control) and PBS group (challenge control) showed severe clinical symptoms, including rough hair, diarrhea, decreased mobility, severe lethargy, and severe ataxia, and died within 3 days (Fig. 6). All the 20 mice in the inactive Salmonella-immunization group (positive control) exhibited slight diarrhea but these symptoms diminished within 3 days with the exception of two mice that died on day 2. Four mice in the rSPV-OmpL immunized group showed severe symptoms of disease and died on day 2, whereas the remaining mice only showed slight clinical symptoms and recovered gradually. The results indicate that rSPV-OmpL provided mice with strong protection against Salmonella challenge.

Fig. 6.Immunoprotection efficacy against challenge by S. typhimurium CVCC542. rSPV-OmpL provided potent immunoprotection with a survival rate of 80%. The immunoprotection efficacy of inactive Salmonella (positive control) was 90%, where only two mice died after lethal challenge. In contrast, all mice in the wtSPV group (negative control) and PBS group (blank control) died within 3 days of challenge.

Passive Immune Protection

Mice passively immunized with hyperimmune sera against OmpL (group 1) showed mild symptoms and recovered within 3 days after challenge with S. typhimurium CVCC542, with the exception of four mice that died. Hyperimmune sera against inactivated Salmonella (group 2) provided 100% protection against Salmonella infection. In contrast, mice in the negative control group and challenge control group (groups 3 and 4) all died. These results confirmed that the antibody against OmpL could provide effective protection against Salmonella infection (Fig. 7).

Fig. 7.Survival rates of mice with passive immune protection after challenge by S. typhimurium CVCC542. Passive immunization with mouse hyperimmune sera against OmpL (group 1) or inactive Salmonella (group 2) provided significant protection against Salmonella lethal challenge. Mice passively immunized with sera against wtSPV (group 3) or PBS (group 4) all died within 2 days post-challenge.

 

Discussion

Salmonella species are common pathogenic bacteria in animals and humans with global distribution, and have adversely affected animal health, human public safety, and food safety. Swine salmonellosis, also known as swine paratyphoid, is characterized by acute sepsis and chronic necrotizing enteritis, which makes epidemic prevention difficult [4]. The short course of the disease, rapid transmission, and high mortality rate cause serious economic losses [18]. The use of antibiotics against Salmonella infection can lead to antibiotic resistance, flora imbalance in the host, and toxin release from bacterial cell lysis. Vaccine immunization is an important measure in the prevention and control of swine salmonellosis, and effective vaccines are needed to raise swine-specific resistance to ensure the safety of public health and the development of the swine industry. Thus, the need for a vaccine against swine salmonellosis is increasingly urgent, but only rarely effective vaccines have been developed [7,25]. Salmonella contains two species, seven subspecies, and approximately 2,500 serovars [27]. Dozens of Salmonella serovars are relatively common in animals, and it is hard to develop vaccines that are effective against all serovars. Analysis of the amino acid sequence of OmpL indicates that this protein is widely distributed in Salmonella spp. and conserved among different Salmonella serovars (Fig. 8), which raises the possibility that OmpL could be a promising target for the development of a general candidate vaccine against Salmonella infection.

Fig. 8.Phylogenetic relationships of 28 strains based on protein sequences of OmpL analyzed using MEGA. Strains in the boxes are 17 Salmonella serovars.

Swinepox virus as a live virus vector is currently widely used for recombinant vaccines [2]. SPV has many advantages as the carrier. First, its replication occurs in the cytoplasm, which avoids the possibility of viral genome integration into host cell chromosomes, thereby eliminating the potential threat to humans and other animals of application of a recombinant virus [31]. Second, exogenous genes can be readily accommodated owing to the large packaging capacity for recombinant DNA of the virus genome [24]. Third, proteins expressed by recombinant SPV usually possess satisfactory immunogenicity [30]. Moreover, SPV has the advantages of low production cost, easy administration, and strict host-range restriction, and thus has real potential as a safe and effective vaccine carrier for wide use in the expression of exogenous genes [3,10,29]. Although SPV does not naturally infect non-swine species, SPV can enter human, monkey, mouse, rabbit, and feline cells to serve as a vector for the expression plasmid [2,3,22,32]. The mouse model is used widely in Salmonella infection studies aimed toward understanding the basis of mucosal immune responses and diseases such as gastroenteritis and typhoid in mice [16]. These conditions set the stage for using mice as the preliminary research animal.

In this study, we evaluated the feasibility of using SPV as a live vector for a Salmonella vaccine. The recombinant SPV we developed, rSPV-OmpL, was genetically stable in PK-15 cells and expressed OmpL correctly. Mice immunized with rSPV-OmpL generated a remarkably high level of specific antibody, as well as Th1-type and Th2-type cytokines. We monitored OmpL-specific antibody titer by indirect ELISA, and the 96-well ELISA plates were coated with 0.2 μg purified prokaryotic expression product of recombinant OmpL in 100 μl of 50 mM sodium carbonate buffer (pH 9.6) and incubated overnight at 4℃. rSPV-OmpL (recombinant vaccine) was able to express foreign protein OmpL exclusively and efficiently. As a live vector, recombinant SPV continued to replicate, proliferate, and express OmpL. Meanwhile, inactive Salmonella (positive control) contains plenty of protein antigens, which distracted the OmpL-specific antibody response.

A novel approach to vaccine development was reported recently [6]. Gas vesicle nanoparticles (GVNPs) produced by extremophilic Halobacterium sp. NRC-1, bioengineered to display the highly conserved Salmonella enterica antigen SopB, were being used to develop an improved vaccine against Salmonella pathogens. Proinflammatory cytokines IFN-γ, IL-2, and IL-9 were significantly induced in mice boosted with this vaccine (SopB-GVNPs), consistent with a robust Th1 response. The animals boosted with SopB-GVNPs resulted in reduced bacterial load in key organs. Nevertheless, this vaccine delayed the death of animals challenged with lethal doses of S. Typhimurium, instead of preventing it (0% survival after pathogen challenge). In contrast with these results, our attempt to use SPV to deliver OmpL had a better immune effect, with 80% protection against Salmonella challenge. rSPV-OmpL (recombinant vaccine) elicited stronger humoral immune responses through a remarkably high level of OmpL-specific antibody as well as Th2-type cytokine IL-4, which was not mentioned for the SopB-GVNP assay. Additionally, passive immune protection confirmed that hyperimmune sera against rSPV-OmpL provide effective protection against Salmonella infection. Taken together, the better protective efficiency, low cost in production, potential for further development by inserting more exogenous genes into the swinepox virus, and low immune doses make the recombinant swinepox virus rSPV-OmpL more competitive than SopB-GVNP.

Unlike inactive Salmonella, rSPV-OmpL as a live virus mainly evokes cell-mediated immunity. IFN-γ represents Th1-type cytokine responses and is positively correlated with the cell-mediated immune response. At 14 and 28 days post primary inoculation, the serum was collected for evaluating the level of IFN-γ, and then booster inoculation were given respectively. The concentration of IFN-γ decreased slightly at 28 days post primary inoculation, as a portion of rSPV-OmpL had been eliminated by the body. IFN-γ in the rSPV-OmpL-vaccinated group was re-increased at 35 days after vaccination because of the second booster inoculation. However, wtSPV and inactive Salmonella had little influence on the cell-mediated immune response comparing the second booster inoculation with the first one.

rSPV-OmpL can express Salmonella protective antigen OmpL continuously and efficiently and elicit a high level of OmpL-specific antibody titer. However, for bacterial pathogens, various kinds of virulence factors have critical roles in complicated pathogenesis. It is unlikely that choosing a single virulence factor as a protective antigen can confer complete protection. Inactive Salmonella (positive control) retains good antigenicity and contains various kinds of virulence factors. Thus, vaccination with inactive Salmonella was a more effective vaccination with rSPV-OmpL both in active immune protection assay and passive immune protection assay.

Taken together, our data indicate that rSPV-OmpL is a promising and attractive vaccine candidate for the prevention and control of Salmonella infection. However, for bacterial pathogens, various kinds of virulence factors have critical roles in the complicated pathogenesis. It is unlikely that choosing a single virulence factor as a protective antigen can confer complete protection. In future work, coexpressing other Salmonella virulence factors will be undertaken in order to develop vaccines that confer better immunoprotection against salmonellosis.