Introduction
Acinetobacter baumannii, Acinetobacter pittii (formerly Acinetobacter genomic species 3), and Acinetobacter nosocomialis (formerly Acinetobacter genomic species 13TU) have emerged as important pathogens that cause a variety of nosocomial infections, including bacteremia, pneumonia, meningitis, urinary tract infections, and wound infections [15, 16, 21]. A. baumannii and A. nosocomialis have similarity in genetic and phenotypic traits [15]. The lifestyle of A. baumannii responsible for the nosocomial infection and its pathogenesis have been well characterized [21]. In particular, the mechanisms of A. baumannii to attach to and form biofilm on abiotic and biotic surfaces are closely linked to its survival in the harsh healthcare environments, such as desiccation, nutrient starvation, and antimicrobial treatments, and its pathogenesis [7, 8, 28]. Accordingly, it has been proceeded to study antibiofilm agents, such as virstatin [3] and 2-aminoimidazoles [27], to A. baumannii. However, specific factors required for the biofilm formation of A. nosocomialis have not yet been characterized.
Many bacteria modulate their communal behaviors, such as virulence factor expression, motility, and biofilm formation, via quorum sensing, a process by which the expression of specific genes is regulated in response to cell-population densities [23]. Diverse gram-negative bacteria are known to use N-acylhomoserine lactones (AHLs) as quorum-sensing signals, which are synthesized by LuxI-type proteins [20]. AHL signals interact directly with cognate LuxR-type regulator proteins, and these complexes bind to specific DNA sequences known as lux boxes to regulate the expression of quorum-sensing target genes [20]. A. baumannii has a typical quorum-sensing system consisting of a LuxItype protein, AbaI, and a LuxR-type protein, AbaR, which is located upstream of AbaI but is transcribed in the opposite direction [1]. AbaI is required for the production of N-(3-hydroxy-dodecanoyl)-L-homoserine lactone (OHdDHL), which is a major quorum-sensing signal in A. baumannii [17]. A. baumannii abaI mutants display deficiency in motility and biofilm formation that are associated with its ability to persist on biotic and abiotic surfaces [5, 17, 26]. The importance of quorum sensing in bacterial pathogenesis has been also shown to be a potential target for the development of antimicrobial therapy that provides promising opportunity to inhibit its pathogenesis without life-or-death pressure [4, 26]. Despite the biological significance of quorum sensing, the quorum-sensing system has not yet been identified and characterized in A. nosocomialis.
In this study, we identified a quorum-sensing system consisting of a LuxI-type protein, AnoI, and a LuxR-type protein, AnoR, by sequence analysis of the A. nosocomialis genome. An AHL produced by A. nosocomialis was identified. The role of AnoI on the production of the AHL in A. nosocomialis was determined by constructing an anoI deletion mutant and analyzing the effects of anoI mutation on the production of the AHL. The functions of AnoR on the expression of anoI and on the biofilm formation and motility in A. nosocomialis were investigated. Furthermore, we not only examined the efficacy of virstatin as an inhibitor of the biofilm formation and motility of A. nosocomialis, but also analyzed its effect on the expression of anoR.
Materials and Methods
Bacterial Strains, Plasmids, and Culture Conditions
All bacterial strains and plasmids used in this study are listed in Table 1. Unless otherwise noted, Escherichia coli and A. nosocomialis were grown in Luria-Bertani (LB) medium at 37°C. For plasmid maintenance in E. coli, chloramphenicol (20 µg/ml) or kanamycin (50 µg/ml) was added to the growth medium. Agrobacterium tumefaciens NT1 (pDCI41E33), a reporter strain, was grown in defined minimal medium at 30℃ [30]. The bioassay plate using the reporter strain was prepared as previously described [19]. Synthetic N-(3-hydroxy-dodecanoyl)- DL -homoserine lactone (Synthetic OH-dDHL) was purchased from Sigma-Aldrich (St. Louis, MO, USA).
Table 1.a Apr, ampicillin resistant; Cmr, chloramphenicol resistant; Kmr, kanamycin resistant, Tetr, tetracycline resistant.
Construction of Deletion Mutants
Each of the anoI and anoR genes was disrupted separately by deletion of the open reading frame (ORF) of each target gene using an overlap extension PCR method as described previously [18]. For example, the amplification of a mutated DNA fragment without anoI was accomplished in two PCR steps with four PCR primers (Table 2) specific to the upstream and downstream regions (approximately 1 kb each) of the coding region of anoI. To combine the upstream and downstream regions of anoI with nptI conferring kanamycin resistance by overlap extension PCR, ANOI02F and ANOI02R primers for amplification of the upstream region were designed to contain additional 25 nucleotides at their 5’ end, which are homologous to the downstream region and nptI. The upstream and downstream regions were amplified from the genomic DNA of A. nosocomialis ATCC 17903 using the primer pairs ANOI01F/ANOI01R and ANOI02F/ANOI02R, respectively. The kanamycin resistance cassette (nptI) was amplified using the primer pair U1/U2 (Table 2) with pUC4K as the template. The three PCR products obtained were mixed at equimolar concentrations and subjected to overlap extension PCR with the ANOI01F and U2 primers. The resulting 3.1 kb DNA fragment was ligated with FspI-digested pHKD01 to generate pOH01 (Table 1). The E. coli S17-1 λpir strain containing pOH01 was used as a conjugal donor to A. nosocomialis ATCC 17903. The conjugation and isolation of the transconjugants were performed as previously described [18]. The anoI deletion mutant was confirmed by PCR analysis. In a similar way, the anoR deletion mutant was constructed and confirmed by PCR analysis. The anoI and anoR deletion mutants were named OH01 and OH02, respectively (Table 1).
Table 2.a The oligonucleotides were designed using the A. nosocomialis ATCC 17903 (GenBank Accession No. GCA_000248315.2) genome sequence. b Regions of oligonucleotides not complementary to the corresponding templates are underlined.
Complementation of Deletion Mutants
To complement the anoI and anoR mutations, the ampicillinresistance gene (bla) of pWH1266 (Table 1) was replaced with the kanamycin resistance gene by subcloning nptI into the pWH1266 that was digested with EcoRI and PstI, and blunt-ended with the Klenow fragment of DNA polymerase I. The new vector was named pOH03 (Table 1). Each of the anoI and anoR ORFs with their native promoter regions was amplified from the genomic DNA of A. nosocomialis ATCC 17903 with the specific primer pairs (Table 2), and then digested with BamHI and SphI. The resulting DNA fragments were subcloned separately into the pOH03 plasmid linearized with the same enzymes to result in pOH04 and pOH05 (Table 1). The plasmids pOH04 and pOH05 were delivered into the anoI mutant and anoR mutant by conjugation, respectively.
Extraction and Detection of AHLs from Bacterial Culture Supernatants
In order to extract AHLs from A. nosocomialis, the bacterial cells were cultivated in Mueller-Hinton (MH) medium for 24 h at 30℃. The cells were removed by centrifugation at 3,500 rpm for 30 min, followed by filtration through a 0.2 µm filter. The supernatants were extracted twice with an equal volume of acidified ethyl acetate. The whole extracts were pooled and dried using a rotary evaporator, Rotavapor (Büchi, Flawil, Switzerland), with the help of vacuum at 30℃ followed by drying on a freeze dryer (Ilshin Biobase, Seoul, Korea). The samples were dissolved in 100 µl of acetonitrile, and 1 µl was loaded to a Waters Acquity H-Class UPLC system interfaced with a Waters SQD2 mass spectrometer (Waters, MA, USA). The chromatographic separation was carried out using a Waters Acquity UPLC BEH C18 octadecylsilane column (2.1 mm × 100 mm, 1.7 µm). The mobile phases A and B were 0.1% formic acid in water and acetonitrile, respectively. The samples were run with a gradient profile as follows (min, mobile phase A: mobile phase B): 0 min, 70%:30%; 5 min, 30%:70%; 6 min, 30%:70%; 6.1 min, 70%:30%; and 10 min, 70%:30%. The mass spectrometric (MS) analysis was performed in the ESI-positive mode, with capillary voltage fixed at 30 V, ion spray voltage at 3 kV, tube lens voltage at 30 V, and capillary temperature at 350℃. The MS data analysis was performed using MassLynx 4.1 software (Waters). As a standard, synthetic OH-dDHL was also analyzed by LC/MS.
Quantitative Real-Time PCR
Total RNAs from the A. nosocomialis strains grown in MH medium (OD600, 2.0) with or without virstatin at 30℃ were isolated with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). cDNA was synthesized from the total RNAs using a PrimeScript RT Master Mix (TaKaRa, Shiga, Japan). Real-time PCR amplification of the cDNA was performed with a Thermal Cycler Dice Real-Time System (TaKaRa) using a SYBR Premix Ex Taq (TaKaRa) and a pair of specific primers, as listed in Table 2. The relative expression level of the targeted gene was calculated using the 16S rRNA expression level as an internal reference for normalization.
Biofilm and Surface Motility Test
For the biofilm formation assay, A. nosocomialis was cultured in MH medium at 30℃. The overnight culture was diluted with the same medium at 1:200, and 1 ml of the diluted culture was incubated in a polystyrene tube (12 × 75 mm) for 8 h at 30℃ without shaking. Planktonic cells were eliminated, and then the tube was washed twice with 1 ml of sterile water. Biofilm cells were stained with 0.1% (w/v) gentian violet solution for 15 min at room temperature. The tube was washed with 1 ml of sterile water three times and subsequently air-dried for 30 min. The biofilms were quantitated by measuring the amount of gentian violet eluted from the biofilm as the optical density at 570 nm (OD570) normalized to total bacterial growth (OD600).
Surface motility was examined on a MH medium containing 0.3% Eiken soft agar (Eiken Chemical, Tokyo, Japan). For the motility test, A. nosocomialis was grown in MH medium until the stationary phase (OD600, 2.0), and 1 µl of the culture was inoculated onto the center of the motility plate. The plate was incubated for 12 h at 30℃ without shaking, and bacterial surface migration on the plate was then photographed by using a digital imaging system (UTA-1100; UMAX Technologies).
Bioassay for the Detection of Autoinducers
A. nosocomialis was grown in MH medium overnight at 3 0℃ and then diluted to an OD600 of 1. Five microliters of the diluted sample was spotted onto the plate overlaid with A. tumefaciens NT1 (pDCI41E33). Synthetic OH-dDHL was also spotted as a control. The plate was incubated at 30℃ for 22 h. The color zone surrounding the bacteria was then photographed by using a digital imaging system (UTA-1100).
Virstatin Effect on Biofilms and Motility
Virstatin (4-[N-(1, 8-naphthalimide)]-n-butyric acid, Enzo Life Sciences, MI, USA) was solubilized in dimethyl sulfoxide (DMSO, Sigma-Aldrich). A. nosocomialis was grown in MH medium and then adjusted to an OD600 of 0.05. Two hundred microliters of the bacterial sample was cultivated in a 96-well plate with various concentration of virstatin or without. The bacterial sample was statically cultured for 12 h at 30℃. The biofilm was quantitated using gentian violet staining. The motility test was conducted in the motility plate with virstatin or without.
Data Analysis and Statistics
Averages and standard errors of the means (SEM) were calculated from at least three independent experiments. All data were analyzed by Student’s t-tests with the SAS program (SAS software; SAS Institute Inc., Cary, NC, USA). Differences between experimental groups were considered to be significant at a P value of <0.005.
Results
Identification and Sequence Analysis of A. nosocomialis AnoI and AnoR
In the course of a search for a quorum-sensing system consisting of LuxI-type synthase and LuxR-type regulator in the A. nosocomialis genome sequence database (GenBank Accession No. GCA_000248315.2), a homology of luxI encoding homoserine lactone synthase was found (Fig. 1A). The putative A. nosocomialis LuxI is composed of 183 amino acid with a theoretical molecular mass of 20,356 Da and a pI of 5.16. The putative LuxI was 94% identical in amino acid sequences to that of the A. baumannii AbaI (Fig. 1B, upper). Furthermore, we found a gene encoding LuxR-type transcriptional regulator that is transcribed divergently from the putative luxI (Fig. 1A). The putative LuxR-type transcriptional regulator was composed of 238 amino acids with a theoretical molecular mass of 27,328 Da and a pI of 5.99. The putative LuxR-type transcriptional regulator revealed a high level of identity (94% in amino acid sequence) with A. baumannii AbaR (Fig. 1B, lower). The putative LuxRtype regulator contains an autoinducer binding domain in the N-terminal part and a helix-turn-helix motif in the Cterminal part (Fig. 1B, lower). Therefore, these information indicate that the putative LuxI and LuxR could be a quorum-sensing system in A. nosocomialis, and thereby were named AnoI (Acinetobacter nosocomialis LuxI) and AnoR (Acinetobacter nosocomialis LuxR).
Fig. 1.Physical map of A. nosocomialis anoI and anoR, and sequence analysis of AnoI and AnoR. (A) The arrows indicate the coding regions of anoI (locus tag number WP_004711097) and anoR (locus tag number WP_004711094), and part of the gene encoding hypothetical protein. The figure was derived using the nucleotide sequences of A. nosocomialis (GenBank Accession No.GCA_000248315.2). (B) The amino acid sequences retrieved from the NCBI protein database (Accession No. WP_004711097 for AnAnoI, YP_001083198 for AbAbaI, WP_004711094 for AnAnoR, and YP_001083200 for AbAbaR) were aligned using the Clustalw program (http://www.ch.embnet.org/software/ClustalW.html). Identical sequences (black boxes) and similar sequences (gray boxes) are represented. The autoinducer binding region (dashed-dotted line) and HTH motif (solid line) are indicated above the amino acid sequence. AnAnoI, A. nosocomialis AnoI; AbAbaI, A. baumannii AbaI; AnAnoR, A. nosocomialis, AnoR; AbAbaR, A. baumannii, AbaR.
Effect of anoI Mutation on the Production of OH-dDHL
OH-dDHL is a major quorum-sensing signal in A. baumannii, and the quorum-sensing signal is synthesized by AbaI [17]. We hypothesized that A. nosocomialis produces OH-dDHL. To examine whether A. nosocomialis produces OH-dDHL, an ethyl acetate extract of culture supernatant was prepared and analyzed by liquid chromatography (LC)/ mass spectrometry (MS). The MS profiles in the culture supernatant were compared with those of a synthetic OH-dDHL (Figs. 2A and 2B). We found the fragment ion at m/z 102, as a characteristic of the homoserine lactone ring, in the MS profiles of the supernatant. By comparison with the synthetic OH-dDHL, the m/z value of 300 in the MS profiles of the A. nosocomialis strain corresponded to that of the synthetic OH-dDHL with a retention time of 5.42 min in the chromatograph. These results indicated that A. nosocomialis produces OH-dDHL as a quorum-sensing signal molecule.
Fig. 2.Mass spectrometry analysis and bioassay of AHL produced by A. nosocomialis. Samples extracted from the bacterial culture supernatants were analyzed by an Acquity H-class liquid chromatography/SQD2 Mass spectrometer (LC/MS) system and the A. tumefaciens biosensor strain containing traG-lacZ. The MS profile of OH-dDHL produced by the wild-type strain (A) or that of the synthetic OH-dDHL (m/z 300) (B) or by the anoI mutant strain (C) is shown. (D) Color zone onto the plate overlaid with A. tumefaciens NT1 (pDCI41E33) was monitored after 22 h and then photographed using a digital imaging system. WT (pOH03), wild type; ∆anoI (pOH03), anoI mutant; ∆anoI (pOH04), complemented strain.
Furthermore, to investigate whether AnoI is required for the production of OH-dDHL, an anoI mutant was constructed by allelic exchange, and the AHL signal produced by anoI mutant was compared with that of wild-type strain by LC/MS analysis and the A. tumefaciens reporter strain containing traG-lacZ (Figs. 2C and 2D). In comparison with the wild-type strain, the m/z value of 300 was not found in the MS profile of the anoI mutant strain. Moreover, the wild-type strain was responsible for the production of blue color zone in the A. tumefaciens reporter strain on the plate. The color zone by the wild-type strain was comparable with that of the synthetic OH-dDHL as a positive control. However, the A. tumefaciens reporter strain failed to produce the color zone in the area spotted with the anoI mutant strain. Deficiency in the color zone by the anoI mutant strain was significantly restored by the introduction of pOH04, indicating that the lack in the color zone by the anoI mutant strain results from inactivation of anoI rather than from any polar effects on genes downstream of anoI. Therefore, the combined results suggested that AnoI is essential for the production of OH-dDHL.
Effect of anoR Mutation on anoI Expression
We found that a putative lux box is located in the upstream region of anoI. Therefore, we hypothesized that the expression of anoI could be regulated by AnoR. To demonstrate this hypothesis, an anoR mutant was constructed by allelic exchange, and the expression levels of anoI in the wild type and anoR mutant were determined by using quantitative real-time PCR (qRT-PCR) (Fig. 3). The expression of anoI was substantially impaired in the anoR mutant. Consequently, the results suggested that AnoR positively regulates the expression of anoI in A. nosocomialis.
Fig. 3.Effect of anoR mutation on anoI expression. The mRNA levels of anoI in wild-type and anoR mutant strains were analyzed by qRT-PCR of the total RNA isolated from the bacterial strains grown in MH medium until stationary phase. Each column represents the mRNA expression level of anoI. Error bars represent the SEM. Mean and SEM values were calculated from three independent experiments. ***, p < 0.005 relative to the wild type. WT, wild type; ∆anoR, anoR mutant.
Effect of anoR Mutation on Biofilm Formation and Motility
To understand the role of AnoR on the biofilm formation of A. nosocomialis, the ability of the wild type and anoR mutant to produce biofilms on a polystyrene surface was assessed by gentian violet staining (Fig. 4A). In comparison with the wild type, the ability of the anoR mutant to produce the biofilm was impaired on the surface, as visualized using a digital imaging system (Fig. 4A, upper). In quantitative biofilm analysis, the ability (OD570 /OD600) of biofilm formation of the wild-type strain was 6.7, whereas the ability of the anoR mutant strain was 3.6 (Fig. 4A, lower). Complementation of the anoR mutation with a functional anoR (pOH05) restored the decreased biofilm formation to a level comparable to that of the wild type (Fig. 4A). These results demonstrated that the decreased biofilm formation in the anoR mutant results from inactivation of anoR rather than from any polar effects on genes downstream of anoR.
Fig. 4.Biofilm formation and surface motility of A. nosocomialis strains. (A) Biofilms formed on 5 ml polystyrene tubes were stained with gentian violet (0.1%) for 15 min (upper). The amounts of gentian violet eluted from the biofilms were quantitated as the OD570 normalized to total bacterial growth (OD600) (lower). (B) The strains were grown at 30°C for 12 h on MH media containing 0.3% Eiken soft agar, and the areas of motility were photographed. Error bars represent the SEM. Mean and SEM values were calculated from three independent experiments. ***, p < 0.005 relative to the wild type. WT (pOH03), wild type; ∆anoR (pOH03), anoR mutant; ∆anoR (pOH05), complemented strain.
Surface motility is regulated by the quorum-sensing system [11]. To examine the role of AnoR on the surface motility of A. nosocomialis, the anoR mutant was tested for its ability to migrate on a semisolid plate surface compared with that of the wild type. As shown in Fig. 4B, the parental wild-type strain was able to migrate away from the inoculation point. However, the anoR mutant strain was significantly impaired in its ability to migrate away from the inoculation point. The deficiency in the motility of anoR mutant was significantly restored by the introduction of pOH05, indicating that AnoR is essential for the motility of A. nosocomialis.
Effects of Virstatin on Biofilm Formation, Motility, and the Expression of anoR
Virstatin is a small organic molecule that inhibits the virulence of Vibrio cholerae by disrupting the dimerization of the transcriptional regulator ToxT [12]. Recently, Chabane et al. [3] presented the efficacy of virstatin as an inhibitor of biofilm formation in A. baumannii. Hence, we investigated the effect of virstatin on the biofilm formation of A. nosocomialis. For this purpose, A. nosocomialis wild-type strains were cultured in the microliter plate walls with different concentrations of virstatin. After 12 h, the biofilm formation was monitored according to the concentration of virstatin by gentian violet staining. As shown in Fig. 5A, biofilm formation was decreased in a dose-dependent manner by virstatin. The biofilm mass in MH medium with 100 µM of virstatin was reduced to about 30% of that in MH medium with DMSO. In addition, we investigated the effect of virstatin on the motility of A. nosocomialis. Reduction of the motility of A. nosocomialis was found in the motility plate containing virstatin (100 µM) (Fig. 5B). To examine whether the reduced biofilm mass or motility resulted from the defects in bacterial growth by virstatin, the growth of A. nosocomialis cultured with DMSO or virstatin (100 µM) was compared. The bacterial growth with virstatin was not different from the bacterial growth without virstatin (Fig. 5C), indicating that virstatin is an inhibitor of the biofilm formation and motility of A. nosocomialis. Based on these results, we hypothesized that the reduction in the biofilm mass and motility by virstatin results from the decreased expression level of anoR. To demonstrate the hypothesis, the expression level of anoR in A. nosocomialis grown in either MH medium with virstatin (100 µM) or DMSO was analyzed by qRT-PCR. The expression level of anoR in the bacteria incubated with virstatin was decreased to about 60% of that in the bacteria incubated with DMSO (Fig. 5D). Therefore, when considering these results, it is reasonable to conclude that virstatin is a small molecule that inhibits the biofilm formation and motility by disrupting the expression of anoR.
fig. 5Effects of virstatin on the biofilm formation and motility of A. nosocomialis. (A) Biofilms were formed in 96-well plates with different concentrations of virstatin and quantitated using gentian violet staining (Materials and Methods). Each column represents the biofilm ability at a different concentration of virstatin. (B) Surface motility was conducted in MH medium containing 0.3% Eiken soft agar with DMSO or 100 µM virstatin. (C) A. nosocomialis was grown in MH medium with DMSO (circles) or 100 µM virstatin (triangles) at 30℃. (D) The mRNA level of anoR was analyzed by qRT-PCR of the total RNA isolated from the bacteria grown in MH medium containing 100 µM virstatin relative to that of the bacteria grown in MH medium alone. Error bars represent SEM. Means and SEM were calculated from three independent experiments. *, p < 0.05; **, p < 0.01; ***, p < 0.005 relative to the wild type with DMSO.
Discussion
Biofilm provides bacteria with a defense against antimicrobial therapies and host immune response during infection as well as various stresses in the environment [10]. The ability of bacteria to produce the biofilm is dependent on their surface motility controlling the establishment and spread of bacterial surface communities [11, 29]. Consequently, it is conceivable that factors contributing to the biofilm formation and motility are critical for the virulence of pathogenic bacteria. Quorum sensing is known to be a major factor that regulates the expression of genes involved in the biofilm formation and surface motility [5, 14, 24]. The quorum-sensing system consisting of AbaI and AbaR has been identified in A. baumannii [17]. Although the role of AbaR has not yet been characterized, it is noteworthy that AbaI plays important roles in the biofilm formation and motility of A. baumannii [5, 17]. In the present study, we identified a quorum-sensing system consisting of LuxI-type protein, AnoI, and LuxR-type protein, AnoR, on the A. nosocomialis ATCC 17903 genome sequence by using homology to the A. baumannii AbaI and AbaR (Fig. 1). The present study showed that OH-dDHL is a quorum-sensing signal produced by A. nosocomialis, and AnoI is essential in the production of OH-dDHL (Fig. 2).
The lux boxes represent a conserved regulatory sequence, which is consistent with direct quorum-sensing control of target genes by LuxR-type proteins and AHLs [20]. The consensus sequence of the lux boxes has been well characterized in Vibrio fischeri and P. aeruginosa. The lux boxes reveal a 20 bp consensus sequence, RNSTGYAXGATNXTRCASRT (N = A, T, C, or G; R = A or G; S = C or G; Y = T or C; X = N or a gap), with palindromic sequences [2, 9]. A putative lux box (CTGTAAATTCTTACAG), a putative DNA binding site for AbaR, has been found at the upstream region of abaI in A. baumannii [17]. We found that a palindromic lux boxlike sequence (ACCTGTAAATTTTTACAGTT) is located in the putative promoter region of anoI in A. nosocomialis. This study showed that anoI is positively regulated by AnoR (Fig. 3). It is likely that AnoR exerts its effect on anoI expression by directly binding to the putative lux box. However, further studies, including EMSA and Chip assay, are needed to clarify the role of AnoR on the expression of anoI. Furthermore, the present study indicated that AnoR is required for the biofilm formation and motility of A. nosocomialis (Fig. 4). Pseudomonas aeruginosa develops biofilm formation through its surface motility, by which the bacterium continuously moves on the surface, multiplies, and forms a uniform biofilm [24]. It is thus possible that mutation of the anoR gene might impair the expression of genes involved in the surface motility of A. nosocomialis, leading to a reduction in its biofilm formation. Therefore, surface motility through an AnoR-dependent quorum-sensing regulatory network could play an important role in the biofilm development of A. nosocomialis. However, further studies on the AnoR-dependent quorum sensing regulatory system are needed to clarify the role of AnoR on the biofilm formation and motility in A. nosocomialis.
Interruption of quorum sensing is an antibacterial therapeutic approach that inhibits the pathogenesis of bacteria [22]. It has been reported that the non-native ligands, containing an aromatic aryl group closely similar to OH-dDHL, block the quorum-sensing system of A. baumannii, leading to inhibition of its motility [26]. Virstatin is known to be a small molecule that inhibits the biofilm formation and motility of A. baumannii [3]. The effects of virstatin on the quorum-sensing-related phenotypes of A. baumannii are noticeable. In the present study, we found that the expression of anoR was decreased by virstatin, leading to a reduction in the biofilm formation and motility of A. nosocomialis (Fig. 5). Virstatin is known to inhibit the dimerization of ToxT, a transcriptional factor responsible for the expression of cholera toxin [12]. It is thus possible that virstatin might interrupt one of the transcriptional factors required for the expression of anoR, leading to a reduction in the expression of anoR. Hence, investigation of the regulatory mechanism of anoR expression is needed to elucidate the effect of virstatin on the expression of anoR. Additional screening by using derivatives related to virstatin is also needed to develop more effective inhibitors to the quorum-sensing system of A. nosocomialis.
In conclusion, the present study demonstrates that AnoI is required for the production of OH-dDHL that is a quorum-sensing signal in A. nosocomialis. AnoR is essential for the expression of anoI, and required for the biofilm formation and motility of A. nosocomialis. Finally, virstatin is a small molecule that inhibits the expression of anoR. Consequently, the combined results suggest that AnoIR is a quorum-sensing system that plays critical roles in the biofilm formation and motility of A. nosocomialis. Derivatives related to virstatin could be used in the development of antibacterial therapeutic agents. Therefore, it is imperative that the roles of AnoIR on the pathogenesis of A. nosocomialis be further examined.
References
- Bhargava N, Sharma P, Capalash N. 2010. Quorum sensing in Acinetobacter: an emerging pathogen. Crit. Rev. Microbiol. 36: 349-360. https://doi.org/10.3109/1040841X.2010.512269
- Callahan SM, Dunlap PV. 2000. LuxR- and acyl-homoserinelactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri. J. Bacteriol. 182: 2811-2822. https://doi.org/10.1128/JB.182.10.2811-2822.2000
- Chabane YN, Mlouka MB, Alexandre S, Nicol M, Marti S, Pestel-Caron M, et al. 2014. Virstatin inhibits biofilm formation and motility of Acinetobacter baumannii. BMC Microbiol. 14: 62. https://doi.org/10.1186/1471-2180-14-62
- Chow JY, Yang Y, Tay SB, Chua KL, Yew WS. 2014. Disruption of biofilm formation by the human pathogen Acinetobacter baumannii using engineered quorum-quenching lactonases. Antimicrob. Agents Chemother. 58: 1802-1805. https://doi.org/10.1128/AAC.02410-13
- Clemmer KM, Bonomo RA, Rather PN. 2011. Genetic analysis of surface motility in Acinetobacter baumannii. Microbiology 157: 2534-2544. https://doi.org/10.1099/mic.0.049791-0
- Cook DM, Li P-L, Ruchaud F, Padden S, Farrand SK. 1997. Ti plasmid conjugation is independent of vir: reconstitution of the tra functions from pTiC58 as a binary system. J. Bacteriol. 179: 1291-1297. https://doi.org/10.1128/jb.179.4.1291-1297.1997
- Dijkshoorn L, Nemec A, Seifert H. 2007. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat. Rev. Microbiol. 5: 939-951. https://doi.org/10.1038/nrmicro1789
- Gaddy JA, Tomaras AP, Actis LA. 2009. The Acinetobacter baumannii 19606 OmpA protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this pathogen with eukaryotic cells. Infect. Immun. 77: 3150-3160. https://doi.org/10.1128/IAI.00096-09
- Gray KM, Passador L, Iglewski BH, Greenberg EP. 1994. Interchangeability and specificity of components from the quorum-sensing regulatory systems of Vibrio fischeri and Pseudomonas aeruginosa. J. Bacteriol. 176: 3076-3080. https://doi.org/10.1128/jb.176.10.3076-3080.1994
- Hall-Stoodley L, Costerton JW, Stoodley P. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2: 95-108. https://doi.org/10.1038/nrmicro821
- Harshey RM. 2003. Bacterial motility on a surface: many ways to a common goal. Annu. Rev. Microbiol. 57: 249-273. https://doi.org/10.1146/annurev.micro.57.030502.091014
- Hung DT, Shakhnovich EA, Pierson E, Mekalanos JJ. 2005. Small-molecule inhibitor of Vibrio cholerae virulence and intestinal colonization. Science 310: 670-674. https://doi.org/10.1126/science.1116739
- Hunger M, Schmucker R, Kishan V, Hillen W. 1990. Analysis and nucleotide sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene 87: 45-51. https://doi.org/10.1016/0378-1119(90)90494-C
- Kim J, Park W. 2013. Identification and characterization of genes regulated by AqsR, a LuxR-type regulator in Acinetobacter oleivorans DR1. Appl. Microbiol. Biotechnol. 97: 6967-6978. https://doi.org/10.1007/s00253-013-5006-7
- Lee YC, Huang YT, Tan CK, Kuo YW, Liao CH, Lee PI, et al. 2011. Acinetobacter baumannii and Acinetobacter genospecies 13TU and 3 bacteraemia: comparison of clinical features, prognostic factors and outcomes. J. Antimicrob. Chemother. 66: 1839-1846. https://doi.org/10.1093/jac/dkr200
- Nemec A, Krizova L, Maixnerova M, van der Reijden TJ, Deschaght P, Passet V, et al. 2011. Genotypic and phenotypic characterization of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex with the proposal of Acinetobacter pittii sp. nov. (formerly Acinetobacter genomic species 3) and Acinetobacter nosocomialis sp. nov. (formerly Acinetobacter genomic species 13TU). Res. Microbiol. 162: 393-404. https://doi.org/10.1016/j.resmic.2011.02.006
- Niu C, Clemmer KM, Bonomo RA, Rather PN. 2008. Isolation and characterization of an autoinducer synthase from Acinetobacter baumannii. J. Bacteriol. 190: 3386-3392. https://doi.org/10.1128/JB.01929-07
- Oh MH, Lee JC, Kim J, Choi CH, Han K. 2015. Simple method for markerless gene deletion of multidrug-resistant Acinetobacter baumannii. Appl. Environ. Microbiol. 81: 3357-3368. https://doi.org/10.1128/AEM.03975-14
- Park SY, Lee SJ, Oh TK, Oh JW, Koo BT, Yum DY, et al. 2003. AhlD, an N-acylhomoserine lactonase in Arthrobacter sp., and predicted homologues in other bacteria. Microbiology 149: 1541-1550. https://doi.org/10.1099/mic.0.26269-0
- Parsek MR, Greenberg EP. 2000. Acyl-homoserine lactone quorum sensing in gram-negative bacteria: a signaling mechanism involved in associations with higher organisms. Proc. Natl. Acad. Sci. USA 97: 8789-8793. https://doi.org/10.1073/pnas.97.16.8789
- Peleg AY, Seifert H, Paterson DL. 2008. Acinetobacter baumannii: emergence of a successful pathogen. Clin. Microbiol. Rev. 21: 538-582. https://doi.org/10.1128/CMR.00058-07
- Rasmussen TB, Givskov M. 2006. Quorum-sensing inhibitors as anti-pathogenic drugs. Int. J. Med. Microbiol. 296: 149-161. https://doi.org/10.1016/j.ijmm.2006.02.005
- Rutherford ST, Bassler BL. 2012. Bacterial quorum sensing: its role in virulence and possibilities for its control. Cold Spring Harb. Perspect. Med. 2: a012427. https://doi.org/10.1101/cshperspect.a012427
- Shrout JD, Chopp DL, Just CL, Hentzer M, Givskov M, Parsek MR. 2006. The impact of quorum sensing and swarming motility on Pseudomonas aeruginosa biofilm formation is nutritionally conditional. Mol. Microbiol. 62: 1264-1277. https://doi.org/10.1111/j.1365-2958.2006.05421.x
- Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Nat. Biotechnol. 1: 784-791. https://doi.org/10.1038/nbt1183-784
- Stacy DM, Welsh MA, Rather PN, Blackwell HE. 2012. Attenuation of quorum sensing in the pathogen Acinetobacter baumannii using non-native N-acyl homoserine lactones. ACS Chem. Biol. 7: 1719-1728. https://doi.org/10.1021/cb300351x
- Thompson RJ, Bobay BG, Stowe SD, Olson AL, Peng L, Su Z, et al. 2012. Identification of BfmR, a response regulator involved in biofilm development, as a target for a 2-aminoimidazole-based antibiofilm agent. Biochemistry 51: 9776-9778. https://doi.org/10.1021/bi3015289
- Tomaras AP, Dorsey CW, Edelmann RE, Actis LA. 2003. Attachment to and biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperoneusher pili assembly system. Microbiology 149: 3473-3484. https://doi.org/10.1099/mic.0.26541-0
- Tucker AT, Nowicki EM, Boll JM, Knauf GA, Burdis NC, Trent MS, et al. 2014. Defining gene-phenotype relationships in Acinetobacter baumannii through one-step chromosomal gene inactivation. mBio 5: e01313-e01314. https://doi.org/10.1128/mBio.01313-14
- Zhang L, Murphy PJ, Kerr A, Tate ME. 1993. Agrobacterium conjugation and gene regulation by N-acyl-L-homoserine lactones. Nature 362: 446-448. https://doi.org/10.1038/362446a0
Cited by
- Transcriptomic analysis of the process of biofilm formation in Rhizobium etli CFN42 vol.198, pp.9, 2015, https://doi.org/10.1007/s00203-016-1241-5
- Different drugs for bad bugs: antivirulence strategies in the age of antibiotic resistance vol.16, pp.7, 2017, https://doi.org/10.1038/nrd.2017.23
- Local Repressor AcrR Regulates AcrAB Efflux Pump Required for Biofilm Formation and Virulence in Acinetobacter nosocomialis vol.8, pp.None, 2015, https://doi.org/10.3389/fcimb.2018.00270
- Multiple Quorum Quenching Enzymes Are Active in the Nosocomial Pathogen Acinetobacter baumannii ATCC17978 vol.8, pp.None, 2015, https://doi.org/10.3389/fcimb.2018.00310
- Acinetobacter baumannii biofilms: effects of physicochemical factors, virulence, antibiotic resistance determinants, gene regulation, and future antimicrobial treatments vol.11, pp.None, 2018, https://doi.org/10.2147/idr.s169894
- Unsaturated Fatty Acids Affect Quorum Sensing Communication System and Inhibit Motility and Biofilm Formation of Acinetobacter baumannii vol.19, pp.1, 2015, https://doi.org/10.3390/ijms19010214
- Characterization of the First “Candidatus Nitrotoga” Isolate Reveals Metabolic Versatility and Separate Evolution of Widespread Nitrite-Oxidizing Bacteria vol.9, pp.4, 2015, https://doi.org/10.1128/mbio.01186-18
- Control of Biofilm Formation in Healthcare: Recent Advances Exploiting Quorum-Sensing Interference Strategies and Multidrug Efflux Pump Inhibitors vol.11, pp.9, 2015, https://doi.org/10.3390/ma11091676
- RND efflux pump systems inAcinetobacter, with special emphasis on their role in quorum sensing vol.49, pp.1, 2015, https://doi.org/10.4167/jbv.2019.49.1.1
- The structure of PilA from Acinetobacter baumannii AB5075 suggests a mechanism for functional specialization in Acinetobacter type IV pili vol.294, pp.1, 2015, https://doi.org/10.1074/jbc.ra118.005814
- AHLs Regulate Biofilm Formation and Swimming Motility of Hafnia alvei H4 vol.10, pp.None, 2015, https://doi.org/10.3389/fmicb.2019.01330
- Characterization and Transcriptome Studies of Autoinducer Synthase Gene from Multidrug Resistant Acinetobacter baumannii Strain 863 vol.10, pp.4, 2015, https://doi.org/10.3390/genes10040282
- Quorum‐sensing system in Acinetobacter baumannii: a potential target for new drug development vol.128, pp.1, 2015, https://doi.org/10.1111/jam.14330
- Quorum Sensing as a Target for Controlling Surface Associated Motility and Biofilm Formation in Acinetobacter baumannii ATCC ® 17978 TM vol.11, pp.None, 2015, https://doi.org/10.3389/fmicb.2020.565548
- Regulatory Mechanisms and Promising Applications of Quorum Sensing-Inhibiting Agents in Control of Bacterial Biofilm Formation vol.11, pp.None, 2015, https://doi.org/10.3389/fmicb.2020.589640
- Stress responses linked to antimicrobial resistance in Acinetobacter species vol.104, pp.4, 2015, https://doi.org/10.1007/s00253-019-10317-z
- Effects of Exogenous N-Acyl-Homoserine Lactones on Biofilm Formation and Motility in Acinetobacter nosocomialis vol.50, pp.2, 2015, https://doi.org/10.4167/jbv.2020.50.2.097
- Effect of quorum sensing and quorum sensing inhibitors on the expression of serine protease gene in Hafnia alvei H4 vol.104, pp.17, 2015, https://doi.org/10.1007/s00253-020-10730-9
- N-3-Hydroxy Dodecanoyl-DL-homoserine Lactone (OH-dDHL) Triggers Apoptosis of Bone Marrow-Derived Macrophages through the ER- and Mitochondria-Mediated Pathways vol.22, pp.14, 2015, https://doi.org/10.3390/ijms22147565