Journal of Microbiology and Biotechnology

The Korean Society for Microbiology and Biotechnology (한국미생물·생명공학회)
권호 표지
DOI QR코드

DOI QR Code

Electricity Generation by Microbial Fuel Cell Using Microorganisms as Catalyst in Cathode

  • Jang, Jae Kyung (Department of Earth Sciences, University of Southern California) ;
  • Kan, Jinjun (Department of Earth Sciences, University of Southern California) ;
  • Bretschger, Orianna (Mork Family Department of Chemical Engineering and Materials Science, University of Southern California) ;
  • Gorby, Yuri A. (The J. Craig Venter Insitute) ;
  • Hsu, Lewis (Department of Civil and Environmental Engineering, University of Southern California) ;
  • Kim, Byung Hong (Department of Earth Sciences, University of Southern California) ;
  • Nealson, Kenneth H. (Department of Earth Sciences, University of Southern California)
  • Received : 2013.11.01
  • Accepted : 2013.11.13
  • Published : 2013.12.28
Download PDF
⟨ Previous Next ⟩

Abstract

The cathode reaction is one of the most seriously limiting factors in a microbial fuel cell (MFC). The critical dissolved oxygen (DO) concentration of a platinum-loaded graphite electrode was reported as 2.2 mg/l, about 10-fold higher than an aerobic bacterium. A series of MFCs were run with the cathode compartment inoculated with activated sludge (biotic) or not (abiotic) on platinum-loaded or bare graphite electrodes. At the beginning of the operation, the current values from MFCs with a biocathode and abiotic cathode were $2.3{\pm}0.1$ and $2.6{\pm}0.2mA$, respectively, at the air-saturated water supply in the cathode. The current from MFCs with an abiotic cathode did not change, but that of MFCs with a biotic cathode increased to 3.0 mA after 8 weeks. The coulomb efficiency was 59.6% in the MFCs with a biotic cathode, much higher than the value of 15.6% of the abiotic cathode. When the DO supply was reduced, the current from MFCs with an abiotic cathode decreased more sharply than in those with a biotic cathode. When the respiratory inhibitor azide was added to the catholyte, the current decreased in MFCs with a biotic cathode but did not change in MFCs with an abiotic cathode. The power density was higher in MFCs with a biotic cathode ($430W/m^3$ cathode compartment) than the abiotic cathode MFC ($257W/m^3$ cathode compartment). Electron microscopic observation revealed nanowire structures in biofilms that developed on both the anode and on the biocathode. These results show that an electron-consuming bacterial consortium can be used as a cathode catalyst to improve the cathode reaction.

Keywords

Introduction

A microbial fuel cell (MFC), a device that uses bacteria as a catalyst to generate electricity, can use various organic wastes and renewable biomass, even inorganic matter and toxic compounds, as electron donors [1,3,7,10,11,12,15,16]. An MFC consists of an anode and a cathode separated by a proton-exchange membrane [3]. At the anode compartment, anaerobic microorganisms are used to biodegrade and produce electrons and protons in the process. Electrons and protons flow to the cathode through the outer circuit and cation-exchange membrane, respectively. These electrons and protons are transferred from the anode compartment and oxygen reacts with them in the cathode compartment. Finally, just energy and water are generated without any toxic by-product. That is, MFCs can be used to generate valuable electricity from impure matter or biodegradable organic matter as well as to treat wastewater, making no demand for the secondary treatment of a useless product. For these reasons, MFCs are capable of providing new opportunities for sustainable energy production from biodegradable matter in the future, and much interest has been taken in them. However, in spite of these positive aspects, it is necessary to overcome some limiting factors regarding MFCs. Gil et al. [3] have found several limiting factors during operating MFCs. One of these limiting factors is the oxygen concentration supplied in the cathode compartment. Among the important factors affecting the efficiency of MFCs is the cathode reaction rate using catalysts and oxygen. Pham et al. [14] determined the quantified concentration of oxygen supplying the cathode reaction. They showed that the critical oxygen concentration was 6.6 mg/l when a bare electrode was used. The reason is that oxygen has a low affinity for the electrode. However, the critical oxygen concentration went down to 2.0 mg/l, below the result based on the use of platinum (Pt) as the catalyst in the cathode. A high oxygen concentration supplied in the cathode can have negative effects because diffused oxygen in the anode compartment can work as an electron acceptor. Therefore, considering the oxygen concentration in the cathode is key to improving the current such that it requires keeping an adequate concentration of oxygen. For this reason, many groups have tried to use catalysts such as Pt and electron acceptors to enhance the cathode reaction capable of operating the MFC.

Recently, MFCs have been studied to improve their performance. Studies in relation to the anode part have been focused on elucidating the electron transport system and improving electricity generation. Gorbi et al. [4] and Reguern et al. [17] showed that electrons could be transferred by a nanowire from the extracellular space to an electrode. In addition, studies in which proteins participate in the electron transport system have been carried out by several groups. Regarding improving the cathode reaction, the various methods that have been tried can be divided into four different types: changing the architecture to increase the surface area, using various catalysts to improve the cathode reaction, transferring electrons from bacteria to the electrode, and internal resistance. Zuo et al. [23] used a tubular membrane cathode to provide the surface area for oxygen reduction at the cathode as well as bacterial growth on the anode. Cheng et al. [2] studied the improvement of the power density using different cathode catalysts such as Pt and cobalt tetra methylphenylporphyrin (CoTMPP) with a polymer binder (Nafion and PTFE). Their results showed that a non-precious metal catalyst such as CoTMPP could replace the Pt-loaded electrode, although it achieved the best performance [2].

Until now, the cathodic reaction in most MFCs has been an abiotic reaction using catalysts such as the reduction of oxygen, ferricyanide, and Pt [14,18]. One possibility of improving the performance of MFCs is the use of microorganisms. Holmes et al. [6] showed that microbial communities associated with the anode and cathode electrodes harvest electricity from a variety of aquatic sediments. This group showed that the nature of the enrichment on the cathodes appeared to be dependent on the environment from which the sediment fuel cells were constructed. However, they did not determine how the microorganisms enriched on the cathode electrode were acting to affect the current. Rhoads et al. [18] also used biomineralized manganese for a cathode reaction. In this study, manganese was microbially deposited on the graphite electrode as manganese oxides and reduced directly, and then reduced Mn2+ was oxidized by Leptothrix discophora in the cathode compartment [18]. He et al. [5] referred to the application of a bacterial biocathode as a catalyst in the cathode compartment as one way of resolving the disadvantageous aspects of MFCs; however, this conclusion was based on supposition, not on an experimental basis.

In this study, an MFC with a biocathode was studied in order to determine the possibility of using bacteria as a catalyst instead of Pt or other abiotic materials. A biotic cathode using aerobic bacteria having low potential can improve current generation because the critical oxygen concentration of aerobic bacteria is known to be 0.2 ppm. Therefore, it can remedy a drastic drawback in terms of practicality.

 

Materials and Methods

MFCs and Their Operation

The MFC was designed to improve energy efficiency in miniature. The anode and cathode compartments (working volume of 3 ml each) were separated by a cation-exchange membrane (Nafion; Dupont Co., USA). Graphite felt (20 × 50 × 3 mm, GF series; Electro-synthesis Co., USA) was used as the electrodes with platinum wire connecting them through a resistor and a multimeter. Two sheets of graphite felt were used in the anode and one in the cathode. The anode compartment was kept anoxic by use of a nitrogen gas bag. Air-saturated water was fed into the cathode compartment in order to supply the oxygen needed for the electrochemical reaction. All MFCs were also operated in continuous flow mode for both compartments. Air-saturated water was fed at a flow rate of 3.76 ± 0.08 ml/min in MFCs with an abiotic cathode. Minimum solution containing inorganic materials such as trace mineral solution, phosphate buffer, and salt solution was fed in the biotic cathode. MFCs were operated at room temperature of around 25 ± 3℃. A resistance of 10 Ω was selected by a resistance box. Optimization was done by varying these standard conditions. Sodium acetate was used as the electron donor, and the chemical oxygen demand (CODchromate) of the wastewater was around 100 mg/l. The salt solution was prepared by mixing 10 ml of trace mineral solution, 30 ml of phosphate buffer (1M,pH7.0), and 950 ml of distilled water. The salt solution contained (NH4)2SO4, 0.56 g; MgSO4 7H2O, 0.20 g; CaCl2, 15 mg; FeCl3·6H2O, 1 mg; MnSO4·H2O, 20 mg; and NaHCO3, 0.42 g. The salt solution was autoclaved at 121℃ for 15 min and cooled under oxygen-free nitrogen gas [8]. It was divided among three groups: w/o Pt, w/o bacteria (Group1); w/Pt, w/o bacteria (Group2); and w/Pt, w/bacteria (Group3). In Group 3 with the biocathode, air-saturated salt solution, including 10 ml of mineral solution, 100 ml of salt solution, and 30 ml of phosphate buffer per liter, was recycled. Air-saturated distilled water in an open reservoir was recycled into the cathode of Groups 1 and 2. The experimental set-up is shown in Fig. 1.

Fig. 1.Diagram of the operation system of the microbial fuel cell with biocathode.

Electrochemical Analysis

The potential between the anode and cathode was measured using a multimeter (Keithly Co., USA) and recorded every 1-5 min by a personal computer using a data acquisition system (Testpoint; Capital Equipment Co., USA). The measured potential was converted to current according to the relationship current = potential/resistance. Coulombs, expressed as current × time, were calculated by integrating the current over time.

Analysis

To measure the chemical oxygen demand (COD) of the organic matter concentration in the artificial wastewater supplied to the anode compartment and the effluent from the anode, an HACH COD kit was used. All experiments were carried out in triple sets and mean values are presented. Dissolved oxygen (Traceable, USA) was measured in a separate bottle, which received effluent from the cathode compartment continuously. The current was considered to be affected by the interference of the high potential used in the oxygen electrode. The bottle was kept full of water to avoid changes in DO by diffusion. The effluent from the cathode compartment was recycled with a flow rate of 3.76 ± 0.08 ml/min in the bottle and continuous stirring. The working volume of the bottle was 320 ml and it was connected to a DO meter, a gas inlet for N2 and air, and an inlet and outlet for liquid. The initial DO concentration was controlled by the air tank to around 7.5- 7.8 mg/l as the O2 concentration. Reaching this value, fed air was cut off and N2 gas was flowed at 30 ml/min.

Bacterial Consortia Collection and DNA Extraction

About 0.5 × 0.5 cm of electrodes for each sample were collected and stored at -80℃ for further analysis. Frozen electrodes were chopped into small pieces with clean blades. DNA from enriched bacterial consortia grown in both anodes and cathodes were obtained by digestion with lysozyme, proteinase K, and sodium dodecyl sulfate concomitant with phenol-chloroform extraction and isopropanol precipitation [21]. Because the graphite fibers were included throughout the extraction procedure, the time for the enzymatic reactions was extended overnight to avoid incomplete reaction. After using a SpeedVac to dry the pellet, DNA was dissolved in ddH2O and stored at 4℃. DNA concentrations were measured based on 260 nm absorbance using an ND-1000 Spectrophotometer (Nanodrop Technologies).

PCR Amplification of 16S rRNA Genes and DGGE

PCR amplification was performed in a 50 μl volume containing approximately 50 ng of template DNA, 1× PCR buffer, 1.5 mM MgCl2, 0.5 mM (each) primer, 200 mM (each) deoxynucleotide, and 2.5 U of Taq DNA polymerase (Qiagen). PCR cycling was performed with a Mastercycler gradient (Eppendorf). Bacteriaspecific PCR primers for DGGE were 341F (GC) (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGCCTA-CGGGAGGCAGCAG) and 907R (CCGTCAATTCMTTTGA GTTT) [20]. The temperature-cycling conditions were as follows: 94℃ for 5 min, a total of 30 cycles were performed at 94℃ for 0.5 min, 55℃ for 1 min, and 72℃ for 3 min, followed by 5 min of incubation at 72℃. After a pre-incubation at 94℃ for 5 min, a total of 27 cycles were performed at 94℃ for 0.5 min, TA for 1 min, and 72℃ for 3 min. In the first 20 cycles, TA was decreased by 1℃ stepwise every two cycles from 65℃ in the first cycle to 56℃ in the 20th. In the last five cycles, TA was 55℃. Cycling was followed by 10 min of incubation at 72℃. Agarose gel electrophoresis was used to detect and estimate the concentration of PCR amplicons.

DGGE was performed using the Dcode Universal Mutation Detection System (Bio-Rad). Similarly sized PCR products were separated on a 1.5-mm-thick vertical gel containing polyacrylamide (acrylamide-bisacrylamide, 37.5:1) and a linear gradient of the denaturants urea and formamide, increasing from 40% at the top of the gel to 80% at the bottom. A similar amount of PCR products was loaded onto the DGGE gel. Electrophoresis was performed at 60℃ in 0.5×TAE buffer, and 70 V of electricity was applied to the submerged gel for 16 h. Nucleic acids were visualized by staining with SYBR Gold and photographed [13].

Sequencing and Phylogenetic Analysis

Representative DNA bands were excised from the DGGE gels, re-amplified, and analyzed by DGGE again. These procedures were repeated three times. The DGGE bands were sequenced using the primer 907R. All sequences were compared with the GenBank database using BLAST, and the closest matched bacterial strains were obtained. Phylogenetic trees were constructed using MacVector 7.1 software package (GCG, Madison, WI, USA). Briefly, sequence alignment was performed with the program CLUSTAL W. Evolutionary distances were calculated by the Jukes-Cantor method [9] and a distance tree was constructed with the neighborjoining algorithm [19].

 

Results

Performance of MFCs with Biocathode and Abiotic Cathode

In the enrichment stage, the fuel including sodium acetate (100 mg/l as COD) was fed into the anode compartment at a flow rate of 0.35 ± 0.01 ml/min. Air-saturated liquid was fed at a flow rate of 0.70 ± 0.10 ml/min in the cathode compartment. The current was stably generated in all of the MFCs 3 weeks after inoculation. The currents were different according to the cathode conditions. The current generated by Groups 1, 2, and 3 was less than 0.04, 0.6, and 0.3 mA, respectively, thereafter becoming stable (data not shown). The control was MFC without Pt and bacteria (Group 1). In the early days when the current was stably generated after enrichment, the current from all MFCs was higher than that of the control. The highest current was generated in the MFC that used only Pt without bacteria. However, the current was unchanged in spite of an increase in the flow rate of the supplying fuel into the anode compartment in the case of all MFCs (data not shown). As measured, the coulomb yield (%) from COD removal and current generation for Groups 1, 2, and 3 was 1.77%, 24.21%, and 15.55%, respectively. As above, the low coulomb yield meant that just a small part of the biodegraded electron donor was converted to electricity. That is, this result may indicate that electrons were sunk somewhere.

Fig. 2.Change of current generation by the increase of the oxidant supply rate.

One of the limiting factors in the operation of MFCs is the oxygen concentration supplied in the cathode compartment, according to Gil et al. [3] and Jang et al. [8]. Therefore, to check the effect of the oxidant, the flow rate of the cathode was gradually increased to 1.87, 2.34, 3.37, and 4.84 ml/min, respectively, starting from 0.70 ml/min. The higher the cathode flow rate, the higher the current generated in all MFCs, as was shown by Gil et al. [3]. When a cathode flow rate of 4.84 ml/min was used, the current of Groups 1, 2, and 3 increased to 0.089 ± 0.002, 2.602 ± 0.159, and 2.275 ± 0.142 mA, respectively. The COD removal of Group 1, which used bacteria without Pt, increased from 18.7 ± 0.6 to 59.7 ± 2.1mg/ l. The COD removal of Group 2, which used only Pt, increased from 28.7 ± 6.7 to 70.7 ± 0.6 mg/l. Moreover, at this time, the coulomb yields of Groups 1, 2, and 3 increased from 1.77% to a maximum of 4.71%, from 24.21% to a maximum of 59.5%, and from 15.5% to a maximum of 47.3%, respectively. By changing the oxidant supply rate, performance was improved in the case of all MFCs. However, when the MFCs were operated for 8 weeks, the current generated by those with a biotic cathode increased to 3.0 mA while that of the abiotic MFCs did not change (Fig. 2).

Fig. 3.Effect of DO concentration on the current generation in the biotic and abiotic cathode MFCs.

Change in Current Generation Under O2-Limited Conditions

These studies were attempted to determine the effect of the DO concentration on current generation in MFCs with a biotic or abiotic cathode. For these studies, fuel with 100 mg/l as COD was fed into the anode compartment at a flow rate of 0.391ml/ min. Air-saturated water or airsaturated salt solution at 3.76 ml/min was used as the oxidant in both abiotic and biotic cathodes. To maintain current stability, N2 gas at 30 ml/min was fed into the reservoir blocked from oxygen and this was continuously fed into the cathode compartment. Fig. 3 shows that the change in current of the MFC using Pt without bacteria (Group 2) and the MFC using both Pt and bacteria (Group 3) was comparable under O2 limitation. As shown in Fig. 3, current generation in the MFC with bacteria (biotic) was dramatically raised in comparison with that of the MFC with Pt and without bacteria.

This result indicates that microorganisms in the cathode positively affected the current generation under a low DO concentration. This demonstrates that the MFC with a biocathode could be used at a lower oxygen concentration than an MFC with only Pt, although the critical oxygen concentration to operate the MFC with the biocathode was higher than that of aerobic bacteria, 0.2 mg/l, in the natural environment. Therefore, considering the change in current due to the oxygen concentration, microorganisms in the cathode (biocathode) might be participating in the consumption reaction of protons and electrons. That is, the cathode reaction exhibited acceleration by microorganisms. Thus, use of microorganisms in the cathode can reduce oxygen diffusion from the cathode to the anode below that of the abiotic cathode because it can be operated at a low concentration of oxygen.

Fig. 4.Effect of alternative respiratory inhibitor in both MFC with bacteria and Pt, and MFC with only Pt.

Effect of an Inhibitor on Current Generation

This study aimed to ascertain whether the current generation was associated with the action of bacteria at the cathode through the use of a respiratory inhibitor. When the current was stably generated at around 3.0 mA, sodium azide (NaN3), which is known as an electron transfer inhibitor, was added to the reservoir at a final concentration of 0.4 mM. Nine to 10 h after the addition of this inhibitor, the current value had dropped from 3.0 mA to 2.8 mA in the MFC using Pt and bacteria (Group 1) (Fig. 4). However, there was no change in current in the abiotic cathode MFC using only Pt.

Phylogenetic Analysis of the Microbial Community in the Cathode

In order to gain further insight into the role of the microorganisms associated with the cathode reaction, the microbial community on the anode and cathode was examined using a denaturing gradient gel electrophoesis (DGGE) and 16S rRNA gene clone library approach. The sequences used were from intense bands in the DGGE fingerprint. The concentration of bacteria at the anode electrode under each condition was 4,518.0, 2,930.0, and 853.5 ng/μl, respectively. The concentration may be dependent on the current. That is, the higher the current generated, the higher the concentration of DNA measured. The concentration of DNA at the cathode electrode of Group 3, which used both Pt and bacteria, was 396.8 ng/μl. In the case of the cathode of Group 2, it was not inoculated but a DNA concentration of 52.8 ng/μl was detected. This seems to have occurred by supplying the oxidant from the open system of the reservoir and crossover of organic matter transported from the anode compartment. However, these bacteria did not seem to act as a catalyst for the cathode reaction. This may mean that the inoculum source is an important factor. The DGGE patterns for each of the MFC conditions were different despite using the same inoculum to enrich the anode and cathode. The microbial community inhabiting the cathode compartment was clearly diverse. As shown at Fig. 5, although microbes lived in the cathode of Group 2, the major bands of lane 7 (w/Pt, w/o bacteria in cathode) were different from those of lane 6 (w/Pt, w/bacteria in cathode). Moreover, the microbial diversity of the anode of the MFC with the biocathode was much greater than otherwise. These results show that improving the cathode reaction rate had the effect of optimizing the overall state of the MFC. This phenomenon eventually appeared as a difference in current value.

Fig. 5.Comparison of the microbial diversity of anode and cathode electrodes in the MFCs with biocathode and abiotic cathode. Denaturing gradient used was 30-70%. Lane 1: Sludge; Lane 2: anode (w/Pt, w/bacteria); Lane3: anode (w/o Pt, w/bacteria); Lane 4: anode (w/Pt, w/o bacteria); Lane 5: anode (w/o Pt, w/o bacteria); Lane 6: cathode (w/Pt, w/bacteria); Lane7: cathode (w/Pt, w/o bacteria).

Table 1.Effluent COD, current, and coulomb yield in MFCs under various flow rates feeding into the cathode.

A total of 16 DGGE phylotypes, as shown in Fig. 6, were identified based on their 16S rRNA gene sequence. Nine of the 16 sequences were related to the Proteobacteria. A close look at these results shows that five were Betaproteobacteria, three were Deltaproteobacteria, and one was Alphaproteobacteria. In addition to this, there were Actinobacteria, Bacteroidetes, and Firmicutes groups. This microbial diversity is similar to that shown by an earlier research group.

 

Discussion

COD Removal and Coulomb Yield with a Change in Cathode Flow Rate

The COD, current, and coulomb yield were measured from the effluent of the anode with a change in the cathode flow rate (Table 1). For the COD measurement, effluent from the anode was taken when the current was stably generated after changing the flow rate. COD removal and current generation improved with increasing flow rate of the cathode. Coulomb yield calculated from these values gradually increased from around 15.6% to 59.51% in both MFCs that used Pt with bacteria and Pt only. However, in MFCs in which the cathode used only bacteria or a bare electrode, the coulomb yield as well as the current value was much lower than the values generated by the MFC mentioned above. This may be due to the effect of the catalysts used in the cathode compartment. This result indicates that the cathode reaction is important for improving the current generation. That is, if one of the limiting factors is not properly adjusted, the current will be reduced. Therefore, when the MFCs were operated, it was important to consider the oxygen supply to the cathode with catalyst as well as electron transfer, proton transfer, low resistance, internal resistance, etc. As many groups have shown, in jumping the current by improving the cathode reaction, the cathode reaction seems to be the most important factor [8, 14]. Moreover, Pt was shown to be a good catalyst, as was mentioned by several groups [8, 14]. However, when bacteria and Pt coexisted in the cathode compartment, the current generation efficiency was improved by around 10% than when Pt only was used.

Fig. 6.Phylogenetic affiliations of representative 16S rRNA gene sequences from excised DGGE bands. Sequences from this study were in bold. Nanoarchaeum equitans was used as an outgroup. Bootstrap values were obtained from the analyses of 1000 resamplings of the dataset. Scale bar = 0.05 substitutions per site.

Evidence of Bacterial Action in the Cathode Compartment

In Fig. 4, the current generated by the MFC with the biotic cathode increased to a certain level and it maintained this value. The current started to slowly drop from 3.0 ± 0.0mA to 2.8 ± 0.0mA after around 20 h. The current increased again when the solution in the reservoir was changed. However, in the MFC with the abiotic cathode, the current remained the same as before. This result seems to provide evidence of bacterial action in the cathode. Additionally, to confirm that current was generated by the action of bacteria, NaN3 was used. NaN3 and antimycin A are known respiratory inhibitors that inhibit bacterial electron carriers and electron transport at different sites of the electron transport chain [22]. Azide is also a potent general metabolic inhibitor, which is largely due to its ability to bind strongly to transition metals contained in metalloenzymes, including cytochrome c oxidase, catalase, and superoxide dismutase, among others. Herein, azide was used to inhibit the bacteria to ascertain their role in current generation. The results demonstrated that the bacteria in the cathode compartment seemed to act to assist the cathode reaction. Moreover, some of these bacteria might directly have used the electrons and protons transferred from the anode compartment as electron donors. The roles of Pt and bacteria in the cathode seem to be related in that they both consume electrons and protons, and catalyze the cathode reaction. Furthermore, protons and electrons may have been used for the bacteria's own growth.

Fig. 7.SEM image of nanowires produced by a mixture of cultured bacteria in the cathode compartment.

Change in the Microbial Community Associated with the Biocathode

The SEM images in Fig. 7 indicate several facts, such as that the bacterial population depended on the current value and electron transport system through nanowires.

In the SEM images, it is apparent that the bacteria had nanowires in the cathode as well as the anode electrode. It can be assumed that bacteria may be used to accept and transfer electrons from the electrode through nanowires. This result is in agreement with the studies of Gorby et al. [4]. This result demonstrates the great possibility that a biocathode can be used as an electricity generation device. The cathode reaction seems to be firmly established by cellcell interactions based on nanowires.

References

  1. Angenent L, Karim K, Al-Dahhan MH, Wrenn BA, Domiguez-Espinosa R. 2004. Production of bioenergy and biochemicals from industrial and agricultural wastewater. Trends Biotechnol. 22: 477-485. https://doi.org/10.1016/j.tibtech.2004.07.001
  2. Cheng S, Liu H, Logan B. 2006. Power densities using different cathode catalysts (Pt and CoTMPP) and polymer binders (Nafion and PTFE) in single chamber microbial fuel cells. Environ. Sci. Technol. 40: 364-369. https://doi.org/10.1021/es0512071
  3. Gil GC, Chang IS, Kim BH, Kim M, Jang JK, Park HS, Kim HJ. 2003. Operational parameters affecting the performance of a mediator-less microbial fuel cell. Biosens. Bioelectron. 18: 327-324. https://doi.org/10.1016/S0956-5663(02)00110-0
  4. Gorby YA, Yanina S, McLean JS, Rosso KM, Moyles D, Dohnalkova A, et al. 2005. Electrically conductive bacterial nanowires produced by Shewanella oneidensis s train MR- 1 and other microorganisms. PNAS 103: 11358-11363.
  5. He Z, Kan J, Wang Y, Huang Y, Mansfeld F, Nealson KH. 2009. Electricity production coupled to ammonium in a microbial fuel cell. Environ. Sci. Technol. 43: 3391-3397. https://doi.org/10.1021/es803492c
  6. Holmes DE, Bond DR, O'Neil RA, Reimers CE, Tender LR, Lovley DR. 2004. Microbial communities associated with electrodes harvesting electricity from a variety of aquatic sediments. Microbial Ecol. 48: 178-190. https://doi.org/10.1007/s00248-003-0004-4
  7. Jang JK, Chang IS, Moon H, Kang KH, Kim BH. 2006. Nitrilotriacetic acid degradation under microbial fuel cell environment. Biotechnol. Bioeng. 95: 772-774. https://doi.org/10.1002/bit.20820
  8. Jang JK, Pham TH, Chang IS, Kang KH, Moon H, Cho KS, Kim BH. 2004. Construction and operation of a novel mediator- and membrane-less microbial fuel cell. Process Biochem. 39: 1007-1012. https://doi.org/10.1016/S0032-9592(03)00203-6
  9. Jukes TH, Cantor CR. 1969. Evolution of protein molecules, In Munro HN (ed.). Mammalian Protein Metabolism. Academic Press, Inc., New York, NY.
  10. Logan BE, Hamelers B, Rozendal R, Schroder U, Keller J, Freguia S, et al. 2006. Microbial fuel cells: methodology and technology. Environ. Sci. Technol. 40: 5181-5192. https://doi.org/10.1021/es0605016
  11. Lovley DR. 2006. Bug juice: harvesting electricity with microorganisms. Nature 4: 497-508.
  12. Lovley DR. 2006. Microbial fuel cells: novel microbial physiologies and engineering approaches. Sci. Biotechnol. 17: 327-332.
  13. Ovreas L, Forney L, Daae FL, Torsvik V. 1997. Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol. 63: 3367-3373.
  14. Pham TH, Jang JK, Chang IS, Kim BH. 2004. Improvement of cathode reaction of a mediatorless microbial fuel cell. J. Microbiol. Biotechnol. 14: 324-329.
  15. Rabaey K, Verstraete W. 2005. Microbial fuel cells: novel biotechnology for energy generation. Trends Biotechnol. 23: 291-298. https://doi.org/10.1016/j.tibtech.2005.04.008
  16. Ravaey K, Lissens G, Siciliano SD, Verstraete W. 2003. A microbial fuel cell capable of converting glucose to electricity at high rate and efficiency. Biotechnol. Lett. 25: 1531-1535. https://doi.org/10.1023/A:1025484009367
  17. Reguera G, Nevin KP, Nicoll JS, Covalla SF, Woodard TL, Lovley DR. 2006. Biofilm and nanowire production leads to increased current in Geobacter sulfurreduceans fuel cells. Appl. Environ. Microbiol. 72: 7345-7348. https://doi.org/10.1128/AEM.01444-06
  18. Rhoads A, Beyena H, Lewandowski Z. 2005. Microbial fuel cell using anaerobic respiration as an anodic reaction and biomineralized manganese as a cathodic reactant. Environ. Sci. Technol. 39: 4666-4671. https://doi.org/10.1021/es048386r
  19. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.
  20. Schafer H, Muyzer G. 2001. Denaturing gradient gel electrophoresis in marine microbial ecology. In Paul J (ed.). Methods in Microbiology. Academic Press, Inc., London.
  21. Schmidt TM, Delong EF, Pace NR. 1991. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing. J. Bacteriol. 173: 4371-4378.
  22. Woznica W, Dzirba J, Manka D, Labuzek S. 2003. Effect of electron transport inhibitor on iron reduction in Aeromonas hydrophila strain KB1. Anaerobe 9: 125-130. https://doi.org/10.1016/S1075-9964(03)00059-3
  23. Zuo Y, Cheng S, Call D, Logan BE. 2007. Tubular membrane cathodes for scalable power generation in microbial fuel cell. Environ. Sci. Technol. 41: 3347-3353. https://doi.org/10.1021/es0627601

Cited by

  1. Three-dimensional X-ray microcomputed tomography of carbonates and biofilm on operated cathode in single chamber microbial fuel cell vol.10, pp.3, 2013, https://doi.org/10.1116/1.4930239
  2. Biomanufacture of nano-Pd(0) by Escherichia coli and electrochemical activity of bio-Pd(0) made at the expense of H 2 and formate as electron donors vol.38, pp.11, 2013, https://doi.org/10.1007/s10529-016-2183-3
  3. Bioelectricity generation from brewery wastewater in a microbial fuel cell using chitosan/biodegradable copolymer membrane vol.14, pp.7, 2017, https://doi.org/10.1007/s13762-017-1258-6
  4. Challenges of Microbial Fuel Cell Architecture on Heavy Metal Recovery and Removal From Wastewater vol.7, pp.None, 2013, https://doi.org/10.3389/fenrg.2019.00001
  5. Bio-energy generation and treatment of tannery effluent using microbial fuel cell vol.287, pp.p1, 2013, https://doi.org/10.1016/j.chemosphere.2021.132090