• 생명과학회지
• /
• 제17권5호
• /
• pp.699-705
• /
• 2007

말 6개 품종 192두를 대상으로 17개의 microsatellite DNA marker를 이용하여 유전자(DNA)형을 분석하여 비교한 결과 제주마에서 각 marker별로 대립유전자의 수는 5-10개(평균 7.35개)로 분포하였고 제주마에서 관찰된 대립유전자는 총 125개가 관찰되어 평균 좌위 당 7.35개로서 몽고마의 130개(평균 7.65개)보다는 낮은 수치였다. 또한 AHT5 marker에서 대립유전자 P, ASB23 marker에서 대립유전자 Q와 R, CA425 marker에서 대립유전자 H, HMS3 marker에서 대립유전자 S, HTG10 marker에서 대립유전자 J, LEX3 marker에서 대립유전자 J 등 6개 marker에서 7개의 특이 대립유전자가 관찰되었다. 관찰된 이형접합성(observed heterozygosity)과 기대된 이형접합성(expected heterozygosity)은 각각 0.429-0.905(평균 0.703)와 0.387-0.841(평균 0.702)로 관찰되었고 다량정보량(PIC)은 0.354(HTG6)-0.816(LEX3)로서 평균 0.659로 나타났으며 17개 marker중 AHT4, AHT5, CA425, HMS2, HMS3, HTG10, LEX3, VHL20 marker 등이 다량정보량(PIC) 0.7 이상을 나타내었다. 17개 marker에 대한 전체 부권부정율(친부마 혹은 친모마 하나의 유전자형을 알고 있을 경우)을 제주마에 적용 시 99.99%로 나타났다. 말 6개 품종별로 분석하였을 때 평균 대립유전자의 수는 7.64개(몽고마)-4.23개(미니츄어 말)로 분포하였고 17개 marker 전체에서는 153개의 대립유전자가 검출되었다. 품종별로 분석한 결과 기대된 이형접합성(expected heterozygosity)과 관찰된 이형접합성(observed heterozygosity)은 각각 0.7950$\pm$0.0141(몽고마)-0.6751$\pm$0.0378(미니츄어 말), 0.7135$\pm$0.0180(제주경주마)-0.5621$\pm$0.0401(미니츄어 말)로 나타났다. 말 6개 품종을 17개 microsatellite marker로 분석한 결과 몽고마, 제주마, 제주경주마 등의 순으로 높은 유전적 다양성을 보였다. 제주마와 가장 가까운 유전적 유연 관계를 나타낸 집단은 몽고마로서 Da genetic distance에서 0.1517로 나타났고, 제주경주마와는 0.2628의 유전적 거리를 보였다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국수산과학회지
• /
• 제36권3호
• /
• pp.317-320
• /
• 2003

Morphologically similar fish species were subjected to the random amplified polymorphic DNA (RAPD) analysis using universal rice primer (URP). The fish species tested were sea basses (Lateolabrax japonicus and L. maculatus), eels (Anguilla japonica, A. bicolor bicolor, A. rostrata, and A. anguilla), and flounders (Limanda yokohamae and L. herzensteinin). Highly reproducible RAPD patterns were observed with several potential species-specific markers. The results indicate that RAPD technique using URP is useful for distinguishing fish psecies in a rapid manner.

• 한국자원식물학회:학술대회논문집
• /
• 한국자원식물학회 2002년도 춘계 학술발표대회
• /
• pp.33-33
• /
• 2002

• 한국버섯학회지
• /
• 제13권1호
• /
• pp.79-83
• /
• 2015

본 연구는 큰느타리버섯의 베타글루칸 고함유 형질에 관련된 SCAR marker를 개발하기 위해 수행되었다. operon사의 OPA(20개), OPB(20개), OPL(20개), OPP(20개), OPR(20개), OPS(20개) 등 총 120개 primer를 random primer(10 mer)로 사용하여 대립 계통 9종과 베타글루칸 고함유 계통 9 종을 대상으로 RAPD를 이용한 bulked segregant analysis를 실시하여 OP-R03 primer로부터 대립 계통에는 나타나지 않고 베타글루칸 고함유 계통에만 나타나는 특이적인 RAPD 밴드를 얻었다. OP-R03 primer를 이용한 RAPD 결과, 약 91 bp 부근에서 베타글루칸 고함유 계통에 특이적인 DNA 밴드가 관찰되었으며 이 DNA 밴드의 염기서열 말단을 근거로 SCAR 마커로 사용할 specific primer인 OP-R03-1-F와 OP-R03-1-R를 디자인하였다. SCAR 마커 OP-R03-1-F/-1-R primer를 이용하여 PCR을 수행한 결과에서도 91 bp 부근에서 대립 계통과 구별되는 DNA 밴드가 베타글루칸 고함유 계통에서 확인되었으며 random primer인 OP-R03 primer를 이용하여 PCR을 수행했을 때보다 재현성이 높고 진한 DNA 밴드임을 확인할 수 있었다.

• 한국버섯학회지
• /
• 제12권3호
• /
• pp.226-231
• /
• 2014

본 연구는 큰느타리버섯의 고온적응성 형질에 관련된 SCAR marker를 개발하기 위해 수행되었다. operon 사의 OPA(20개), OPB(20개), OPL(20개), OPP(20개), OPR(20개), OPS(20개) 등 총 120개 primer를 random primer(10 mer)로 사용하여 대립 계통 7종과 고온성 계통 7 종을 대상으로 RAPD를 이용한 bulked segregant analysis를 실시하여 OP-A06 primer로부터 대립 계통에는 나타나지 않고 고온성 계통에만 나타나는 특이적인 RAPD 밴드를 얻었다. OP-A06 primer를 이용한 RAPD 결과, 약 385 bp 부근에서 고온성 계통에 특이적인 DNA 밴드가 관찰되었으며 이 DNA 밴드의 염기서열 말단을 근거로 SCAR 마커로 사용할 specific primer인 OP-A06-1-F와 OP-A06-1-R를 디자인하였다. SCAR 마커 OP-A06-1-F/-1-R primer를 이용하여 PCR을 수행한 결과에서도 385 bp 부근에서 대립 계통과 구별되는 DNA 밴드가 고온성 계통에서 확인되었으며 random primer인 OP-A06 primer를 이용하여 PCR을 수행했을 때보다 재현성이 높고 진한 DNA 밴드임을 확인할 수 있었다.

• 대한본초학회지
• /
• 제29권6호
• /
• pp.35-43
• /
• 2014

Objectives : Official Arisaematis Rhizoma is described only three species, Arisaema amurnse, Arisaema erubescens, and Arisaema heterophyllum, in national Pharmacopoeia. However, other Arisaema species, Arisaema ringens, Arisaema takesimense and Arisaema serratum, also have been distributed as an inauthentic Arisaematis Rhizoma in the herbal market. To develop a reliable molecular authentication method for Arisaematis Rhizoma in species level, we analyzed DNA barcode regions using six Arisaema species. Methods : Thirty-eight samples of six Arisaema plants species (A. amurense, A. amurense f. serratum, A. heterophyllum, A. takesimense, and A. serratum) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL gene) were analyzed after PCR amplification. The species-specific sequences and phylogenetic relations were estimated using entire sequences of three DNA barcodes based on the analysis of ClastalW and UPGMA, respectively. Results : The comparative analysis of DNA barcode sequences were revealed inter-species specific nucleotides to distinguish the medicinal plant of Arisaema Rhizoma in species levels excluding between A. amurense and its subspecies (A. amurense f. serratum) and A. takesimense and A. serratum, respectively. However, we obtained sequence differences enough to discriminate authentic and inauthentic Arisaematis Rhizoma. Therefore, we suggest that these SNP type molecular genetic markers were an reliable method avaliable to identify official herbal medicines. Conclusions : These marker nucleotides could be useful to identify the official herbal medicines by providing definitive information that can identify original medicinal plant and distinguish from inauthentic adulterants and substitutes.

• 한국정보통신학회:학술대회논문집
• /
• 한국정보통신학회 2017년도 춘계학술대회
• /
• pp.288-290
• /
• 2017

최근 증강 현실(AR)의 응용분야로 AR 콘텐츠의 관심과 수요가 증가하고 있다. 일반적으로 실외환경에서 AR 콘텐츠를 서비스할 때 AR 스크린 위에 오브젝트의 표출을 제어하기 위해 GPS 신호를 이용한 위치 정보를 사용하거나 사물의 이미지를 기반으로 하는 마커를 사용한다. 그러나 실내 환경에서의 경우 위치 정보를 이용할 수 없다는 문제점이 있다. 만약 마커만을 이용하여 서비스를 제공하는 경우 주변의 이동하는 장애물로 인한 마커의 인식이 불안정하다는 문제점 또한 갖는다. 그리고 AR 스크린 상에 표시되는 정보가 특정 위치에 고정 상태로 표시되는 것이 아닌 카메라의 이동에 따라 이동한다는 문제점을 갖는다. 본 논문에서는 iBeacon을 이용하여 실내 위치 인식과 특정 마커를 이용하여 AR 스크린에 표출될 객체를 정확한 위치에 나타내기 위한 오브젝트 제어 방법에 대해 연구하였다.

• Food Science and Biotechnology
• /
• 제17권6호
• /
• pp.1221-1227
• /
• 2008

The application of the cellulase gene (celA) as a selection marker of food-grade integration system was investigated in Lactobacillus (Lb.) casei, Lactococcus lactis, and Leuconostoc (Leu.) mesenteroides. The 6.0-kb vector pOC13 containing celA from Clostridium thermocellum with an integrase gene and a phage attachment site originating from bacteriophage A2 was used for site-specific recombination into chromosomal DNA of lactic acid bacteria (LAB). pOC13 was also equipped with a broad host range plus replication origin from the lactococcal plasmid pWV01, and a controllable promoter of nisA ($P_{nisA}$) for the production of foreign proteins. pOC13 was integrated successfully into Lb. casei EM116, and pOC13 integrants were easily detectable by the formation of halo zone on plates containing cellulose. Recombinant Lb. casei EM 116::pOC13 maintained these traits in the absence of selection pressure during 100 generations. pOC13 was integrated into the chromosome of L. lactis and Leu. mesenteroides, and celA acted as an efficient selection marker. These results show that celA can be used as a food-grade selection marker, and that the new integrative vector could be used for the production of foreign proteins in LAB.

• 대한본초학회지
• /
• 제28권3호
• /
• pp.75-84
• /
• 2013

Objectives : The origin of Breeae Herba (So-gye) and Cirsii Herba (Dae-gye) is differently prescribed in Korean and Chinese modern pharmacopoeia. Since the similar morphological characteristics and chaotic plant names, moreover, the aerial part of Carduus crispus have been used as the Cirsii Herba. To develop a reliable method for correct identification of these herbal medicines and to evaluate the genetic relationship of these closely related plant species, we analyzed sequences of DNA barcode regions. Methods : Thirty-one samples of 6 medicinal plants (B. segeta, B. setosa, C. japonicum var. maackii, C. setidens, C. chanroenicum, and C. crispus) were collected from different habitate and nucleotide sequences of DNA barcode regions (rDNA-ITS, matK, and rbcL) were analyzed after amplification using appropriate primers reported in previous studies. The nucleotides of species-specific authentic marker and phylogenetic relations were estimated based on the entire sequences of DNA barcodes by the analysis of ClastalW and UPGMA, respectively. Results : In comparative analysis of DNA barcode sequences, we obtained specific nucleotides to discriminate the medicinal plant of Breeae/Cirsii Herba in species level and evaluated the phylogenetic relationship of these species. Futhermore, we identified distinct marker nucleotides enough to authenticate respective species. These sequence differences at corresponding positions were avaliable genetic markers to determine the botanical origins of Breeae Herbal as well as Cirsii Herba. Conclusions : These marker nucleotides would be useful to identify the official herbal medicines by providing of definitive information that can identify each plant species and distinguish from unauthentic adulterants and substitutes.