• Mycobiology
• /
• v.39 no.2
• /
• pp.71-78
• /
• 2011

The phylogenetic relationships of the most dominant and morphologically cryptic endophytic fungal isolates from each of five selected medicinal plants, namely Potentilla fulgens, Osbeckia stellata, Osbeckia chinensis, Camellia caduca, and Schima khasiana of the biodiversity rich state of Meghalaya, were assessed with random amplification of polymorphic DNA and PCR-restriction fragment length polymorphism profiles. Sequencing of the internal transcribed spacer 1, small subunit rRNA and partial ${\beta}$-tubulin gene fragments was also conducted to determine the phylogenetic relationships of these isolates with fungal sequences available in Genbank, NCBI. The identity of the fungal isolates is suggested based on the molecular phylogenetic data.

• The Korean Journal of Mycology
• /
• v.49 no.4
• /
• pp.531-537
• /
• 2021

Styrax japonicus is a deciduous shrub or a small tree belonging to the family Styracaceae. Since 1990, a rust fungus has continuously been found on S. japonicus leaves across the country. The morphological characteristics of the rust fungus were most consistent with those of Pucciniastrum styracinum reported on Styrax obassia in Japan. The species identification was confirmed by molecular phylogenetic analysis of the internal transcribed spacer and large subunit rDNA sequences. The current study provides mycological information with morphological measurements and molecular phylogenetic data of P. styracinum found on S. japonicus in Korea. Therefore, this is the first confirmed report on the presence of P. styracinum on S. japonicus in Korea.

• ALGAE
• /
• v.28 no.3
• /
• pp.213-231
• /
• 2013

Amphidinium massartii Biecheler is an epiphytic and toxic dinoflagellate. Prior to the present study, A. massartii has been reported in the waters off the Mediterranean, Australian, USA, and Canadian coasts. We isolated Amphidinium cells from the coastal waters of Jeju Island, Korea and their morphology and rDNA sequences indicated that they were A. massartii. Herein, we report for the first time the occurrence of A. massartii in the waters of the temperate region in the northwestern Pacific Ocean. The large subunit (LSU) rDNA sequences of the Korean strains were 0.7% different from those of an Australian strain of A. massartii CS-259, the closest species, but were 4.1-5.8% different from those of the other Australian strains and the USA strains of A. massartii and from those of Amphidinium sp. HG115 that was isolated from subtropical Okinawan waters. In phylogenetic trees based on LSU, internal transcribed spacer, small subunit rDNA, and cytochrome b sequences, the Korean strains belonged to the A. massartii clade, which was clearly divergent from the A. carterae clade. The morphology of the Korean A. massartii strains was similar to that of the originally described French strain and recently described Australian strain. However, we report for the first time here that scales were observed on the surface of the flagella. In conclusion, the Korean A. massartii strains have unique rDNA sequences, even though they have a very similar morphology to that of previously reported strains. This report extends the known range of this dinoflagellate to the temperate waters of the northwestern Pacific Ocean.

• ALGAE
• /
• v.34 no.4
• /
• pp.267-275
• /
• 2019

Three new species of the genus Micractinium were collected from five localities on the South Shetland Islands in maritime Antarctica, and their morphological and molecular characteristics were investigated. The vegetative cells are spherical to ellipsoidal and a single chloroplast is parietal with a pyrenoid. Because of their simple morphology, no conspicuous morphological characters of new species were recognized under light microscopy. However, molecular phylogenetic relationships were inferred from the concatenated small subunit rDNA, and internal transcribed spacer (ITS) sequence data indicated that the Antarctic microalgal strains are strongly allied to the well-supported genus Micractinium, including M. pusillum, the type species of the genus, and three other species in the genus. The secondary structure of ITS2 and compensatory base changes were used to identify and describe six Antarctic Micractinium strains. Based on their morphological and molecular characteristics, we characterized three new species of Micractinium: M. simplicissimum sp. nov., M. singularis sp. nov., and M. variabile sp. nov.

• Parasites, Hosts and Diseases
• /
• v.47 no.3
• /
• pp.293-297
• /
• 2009

Improved methods for detection of Cryptosporidium oocysts in environmental and clinical samples are urgently needed to improve detection of cryptosporidiosis. We compared the sensitivity of 7 PCR primer sets for detection of Cryptosporidium parvum. Each target gene was amplified by PCR or nested PCR with serially diluted DNA extracted from purified C. parvum oocysts. The target genes included Cryptosporidium oocyst wall protein (COWP), small subunit ribosomal RNA (SSU rRNA), and random amplified polymorphic DNA. The detection limit of the PCR method ranged from $10^3$ to $10^4$ oocysts, and the nested PCR method was able to detect $10^0$ to $10^2$ oocysts. A second-round amplification of target genes showed that the nested primer set specific for the COWP gene proved to be the most sensitive one compared to the other primer sets tested in this study and would therefore be useful for the detection of C. parvum.

• The Plant Pathology Journal
• /
• v.15 no.1
• /
• pp.28-33
• /
• 1999

Phytophthora root rot of Chniese cabbage and spinach is reported for the first time in Korea. The diseases ocurred at Yangju, Seosan and Yeocheon in Korea from 1995 through 1998, mainly in lowland and submerged areas. Symptoms consisted of stunt, yellows, wilt and eventual death due to root rot. Fourteen isolates collected from naturally infected plants were all identified as P. drechsleri based on mycological characteristics. PCR-RFLP analysis of rDNA of the isolates confirmed the above result, since the restriction band patterns of the small subunit and internal transcribed spacers were identical to P. drechsleri and P. cryptogea, but distinct from closely related species of P. erythroseptica, P. cambivora, P. sojae and P. megasperma. The pathogen showed strong pathogenicity to Chinese cabbage, moderate to spinach, radish, cabbage and tomato, and weak or none to brown mustard, kale, chicory and pepper in pathogenicity tests.

• Animal Systematics, Evolution and Diversity
• /
• v.36 no.2
• /
• pp.113-122
• /
• 2020

From a moss sample, we isolated and identified Notohymena gangwonensis Kim et al., 2019 based on morphological and molecular data. The moss and type population has completely identical 18S rRNA (nuclear small subunit ribosomal RNA) gene sequences and both are highly similar in morphological and morphometric attributes, except for the diameter and arrangement of the cortical granules. Thus, we reexamined the type materials(i.e., micrographs and gDNA) and resulted in finding mistakes made by the authors of the species. Based on these data and supporting materials newly obtained (i.e., internal transcribed spacer [ITS] 1, ITS2, 5.8S, and partial 28S rDNA sequences, and scanning electron micrographs), we provide improved diagnosis of the species to clarify its identity. In addition, a key for Notohymena species is provided.

• Journal of Marine Bioscience and Biotechnology
• /
• v.2 no.1
• /
• pp.60-67
• /
• 2007

For the first time in Vietnam, morphological and molecular studies of a species belonging to Bacillariophyceae collected in Northern coast of Vietnam are presented. Observations with microscope showed that this species belong to genus: Pseudo-nitzschia and seem like P. pungens. Sequence data from the partial 18S small subunit ribosomal RNA gene (18S rDNA) and the internal transcribed spacer 1 - 5.8S - internal transcribed 2 have been used to determine clearly and generate a phylogenetic framework of the obtained sequences to previously reported sequences in GenBank. These results allowed us to highlight described species of Bacillariophyceae in Northern coast of Vietnam. Furthermore, accumulation of molecular study would be helpful for the identification of scientific name of harmful algal species and further taxonomic studies in Vietnam.

• Mycobiology
• /
• v.43 no.4
• /
• pp.392-401
• /
• 2015

Using dilution plating method, 47 fungal isolates were obtained from a soil sample collected from Dokdo in the East Sea of Korea in 2013. In this study, two fungal isolates, EML-MFS30-1 and EML-DDSF4, were confirmed as undescribed species, Metarhizium guizhouense and Mortierella oligospora in Korea based on current classification system using multi loci including rDNA internal transcribed spacer, large subunit, small subunit, and ${\beta}$-tubulin (BTUB) genes. Herein, detailed morphological descriptions on characters of the undescribed fungal species as well as their molecular phylogenetic status are provided with comparisons to related species.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.