• Restorative Dentistry and Endodontics
• /
• 제43권2호
• /
• pp.19.1-19.10
• /
• 2018

Objectives: This study investigated the effect of continuous application of 10-methacryloyloxydecyldihydrogen phosphate (MDP)-containing primer and luting resin cement on bond strength to tribochemical silica-coated yttria-stabilized tetragonal zirconia polycrystal (Y-TZP). Materials and Methods: Forty bovine teeth and Y-TZP specimens were prepared. The dentin specimens were embedded in molds, with one side of the dentin exposed for cementation with the zirconia specimen. The Y-TZP specimen was prepared in the form of a cylinder with a diameter of 3 mm and a height of 10 mm. The bonding surface of the Y-TZP specimen was sandblasted with silica-coated aluminium oxide particles. The forty tribochemical silica-coated Y-TZP specimens were cemented to the bovine dentin (4 groups; n = 10) with either an MDP-free primer or an MDP-containing primer and either an MDP-free resin cement or an MDP-containing resin cement. After a shear bond strength (SBS) test, the data were analyzed using 1-way analysis of variance and the Tukey test (${\alpha}=0.05$). Results: The group with MDP-free primer and resin cement showed significantly lower SBS values than the MDP-containing groups (p < 0.05). Among the MDP-containing groups, the group with MDP-containing primer and resin cement showed significantly higher SBS values than the other groups (p < 0.05). Conclusions: The combination of MDP-containing primer and luting cement following tribochemical silica coating to Y-TZP was the best choice among the alternatives tested in this study.

• The Journal of Advanced Prosthodontics
• /
• 제16권3호
• /
• pp.163-173
• /
• 2024

PURPOSE. This study assessed the effect of storage time on chemical structure of a single-bottle and a two-bottle experimental ceramic primer and micro-shear bond strength (µSBS) of composite to ceramic. MATERIALS AND METHODS. This study was conducted on 60 sintered zirconia and 60 feldspathic porcelain blocks. Half of the specimens (n = 30) were subjected to surface treatment with the single-bottle Clearfil ceramic primer (n = 15) and two-bottle experimental primer (n = 15) after 24 hours. The remaining half received the same surface treatments after 6 months storage in distilled water. Composite cylinders were bonded to the ceramics, and they were then subjected to µSBS test. Also, the primers underwent Fourier-transform infrared spectroscopy (FTIR) after 24 hours and 6 months to assess their chemical structure. Data were analyzed with 3-way ANOVA and adjusted Bonferroni test (alpha = 0.05). RESULTS. The µSBS of both ceramics significantly decreased at 6 months in one-bottle ceramic primer group (P = .001), but it was not significantly different from the two-bottle experimental primer group (P = .635). FTIR showed hydrolysis of single-bottle primer, cleavage of silane and 10-MDP bonds, and formation of siloxane bonds after 6 months. CONCLUSION. Six months of storage caused significant degradation of single-bottle ceramic primer, and consequently had an adverse effect on µSBS.

• 대한치과교정학회지
• /
• 제31권1호
• /
• pp.137-147
• /
• 2001

Acidic primer는 하나의 용액으로 conditioning과 priming을 동시에 시행하는 새로운 접착 시스템으로 치질의 손상이 적고 처리 과정이 간단한 특징을 지닌다. 본 실험은 acidic primer를 이용하여 치면처리를 시행한 후 기존의 접착제로 브라켓을 접착할 때 적절한 결합강도를 지니는지 평가하기 위하여 고안되었다. 50개의 사람 소구치를 5개군으로 나누어 4개군은 acidic primer로 법랑질을 처리한 후 Clearfil Liner bond $2^{\circledR}$(1군), Transbond $XT^{\circledR}$(2군), Panavla $21^{\circledR}$(3군), Fuji Ortho $LC^{\circledR}$(4군)로 브라켓을 접착하였고 1개군은 TransHond $XT^{\circledR}$를 통상적인 산부식 방법을 이용하여 접착(5군)한 후 전단 결합 강도를 측정하고 접착파절의 양상을 평가하여 다음과 같은 결론을 얻었다. 1 Acidic primer로 처리한 4개의 군 가운데 광중합형 글래스 아이오노머를 사용한 군(4군)의 전단결합강도($9.72{\pm}3.16MPa$)와 Panavia $21^{\circledR}$을 사용한 군(3군)의 전단 결합 강도($8.69{\pm}2.72MPa$)는 37$\%$ 인산으로 처리한 후 광중합형 레진 (Transbond $XT^{\circledR}$)을 사용한 군(5군)의 전단결합강도($10.48{\pm}2.60MPa$)와 유의성있는 차이를 보이지 않았다 (P>0.05). 2. Acidic primer로 처리한 4개의 군 가운데 광중합형 글래스 아이오노머를 사용한 군(4군)과 Panavia $21^{\circledR}$을 사용한 군(3군)의 전단 결합 강도는 Clearfil Liner bond $2^{\circledR}$를 사용한 군(1군)의 전단 결합 강도($1.09{\pm}0.53MPa$)와 광중합형 레진(Transbond $XT^{\circledR}$)을 사용한 군(2군)의 전단 결합 강도($2.70{\pm}1.46MPa$)에 비해 유의하게 큰 강도를 보였다 (p<0.05). 3. 접착제 잔류지수 측정 결과 4군($2.1{\pm}1.1$)과 5군($2.9{\pm}0.3$)의 경우 1군($0.2{\pm}0.4$), 2군($0.3{\pm}0.9$), 3군($0.2{\pm}0.4$)에 비해 접착제 잔류지수가 유의하게 높았다 (p<0.05). 4. 4군과 5군의 접착제 잔류 지수간에는 유의한 차이가 없었다 (p>0.05). 따라서 acidic primer로 치면을 처리하는 방법은 시용되는 접착제에 따라 기존의 산부식 접 착법과 유사한 결합강도를 얻을 수 있어 교정용 브라켓 접착시 산부식 단계를 생략할 수 있는 가능성을 보여준다.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• BMB Reports
• /
• 제38권1호
• /
• pp.24-27
• /
• 2005

The role of 3' exonuclease excision in DNA polymerization was evaluated for primer extension using inert allele specific primers with exonuclease-digestible ddNMP at their 3' termini. Efficient primer extension was observed in amplicons where the inert allele specific primers and their corresponding templates were mismatched. However, no primer-extended products were yielded by matched amplicons with inert primers. As a control, polymerase without proofreading activity failed to yield primer extended products from inert primers regardless of whether the primers and templates were matched or mismatched. These data indicated that activation was undertaken for the inert allele specific primers through mismatch proofreading. Complementary to our previously developed SNP-operated on/off switch, in which DNA polymerization only occurs in matched amplicon, this new mutation detection assay mediated by $exo^+$ DNA polymerases has immediate applications in SNP analysis independently or in combination of the two assays.

• Asian Pacific Journal of Cancer Prevention
• /
• 제17권7호
• /
• pp.3065-3069
• /
• 2016

Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP).

• 대한치과보존학회:학술대회논문집
• /
• 대한치과보존학회 2003년도 제120회 추계학술대회 제 5차 한ㆍ일 치과보존학회 공동학술대회
• /
• pp.625-625
• /
• 2003

I. Objectives Self-etching primer adhesive system is affected to dentin surface conditioning and priming. Especially application time of self-etching primer is very important factor of clinical procedure which has direct influence on smear layer, etching reaction and primer penetration to dentin. This study evaluated the influence of application time of self-etching primers on microtensile bond strength (${\mu}{\;}TBS$) to dentin using three self-etching primer adhesive systems.(omitted)

• International Journal of Naval Architecture and Ocean Engineering
• /
• 제13권1호
• /
• pp.707-717
• /
• 2021

To the date, shipbuilding companies have applied shop primer coating which protects the steel surface from global oxidization in environment. Proper shop primer requires either anti-corrosion ability during construction or anti-porosity ability during welding, and those properties contradict to each other. This report tried to derive an optimizing parameter on these conflicting properties to select a proper shop primer. First, sufficient amounts of the natural salt spray tests were carried out to achieve a series of data for the anti-corrosion ability. Second, lots of T-joint fillet welding test were performed to evaluate the trapped porosity formed in the weld pool. According to the experimental data, we could achieve either the rust-formation rate or the porosity-formation rate, then, each rate was generalized as formulae. Then, we tried to combine these conflicting properties to decide an optimum shop primer.

• 한국식물병리학회:학술대회논문집
• /
• 한국식물병리학회 2003년도 정기총회 및 추계학술발표회
• /
• pp.136.2-137
• /
• 2003

In order to diagnose and differentiate jujube witches' broom (JWB) phytoplasma rapidly, oligonucleotide primer pair, 16Sr(V) F/R, for polymerase chain reactions (PCRs) was designed on the basis of 165 rRNA sequences of JWB phytoplasma. The PCR employing phytoplasma universal primer pair P1/P7 consistently amplified DNA in all tested phytoplasma isolates. But no phytoplasma DNA was detected in healthy jujube seedlings. The nested PCR, the primer pair 16S(V) F/R, about 460 bp fragment, amplified DNA in all tested JWB and related phytoplasmas including LiWB phytoplasma of the 165 rRNA group V, but no DNA amplification was detected from other phytoplasma strains such as group 16SrI (Aster yellows) and group 16SrⅩII (Stolbur group) phytoplasmas in which mulberry dwarf phytoplasma and chrysanthemum witches broom phytoplasma are belonged to, respectively The same results were obtained from both Korean- and Chinese-isolates of JWB. Nested-PCR using phytoplasma universal primer pair P1/P7 and 16S rRNA group V specific primer pair 16S(V) F/R could detect group V phytoplasma rapidly and easily, in particular JWB phytoplasma.

• 미생물학회지
• /
• 제40권2호
• /
• pp.167-171
• /
• 2004

효과적인 원위치 중합효소 연쇄반응 (In situ PCR)을 위해서는 증폭된 PCR 산물의 세포외 유출을 감소시켜야 한다. 이를 위한 한 방법으로 거대분자 PCR 산물을 합성시키기 위한 5'쪽에 서로 상보적인 꼬리서열을 가진 프라이머(꼬리 프라이머; tailed primer)가 사용되었으나 많은 PCR 횟수로 인해 시간의 낭비와 세포조직의 형태보존성이 저하되는 문제가 발생하였다. 따라서 PCR 조건을 가능한 최적화시키고, 최소의 PCR 횟수로써 세포외 유출을 막을 수 없는 방법이 필요하게 되었다. 이러한 방법의 일환으로 꼬리 프라이머를 이용하여 PCR 튜브 속에서 목표 핵산없이 프라이머 중합체(primer polymers)의 형성을 유도하였고, 이를 유리 슬라이드위에 고정시킨 Molt/LAV 세포들에 처리하여 20 회의 짧은 시간에서도 적절한 탐침을 할 수 있게 되었다. 이로 인해 프라이머 중합체의 원위치 중합효소 연쇄반응에서의 사용가능성을 타진하였다.