Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
When we have both a paired data set and two independent data sets, neither a paired t-test nor a two-sample t-test can be used to detect differences between two samples. In order to identify differentially expressed genes in a mixed data set, a new test statistic is proposed.
Background: Bisphenol A (BPA), an endocrine disrupting chemical, has been suspected to pose carcinogenic risks. However, likely mechanisms are obscure and there are difficulties to estimating its real significance for cancer development. Methods: We therefore studied BPA-induced proteomic alterations in immune organs of ICR mice offspring that were prenatally exposed to BPA (15 and 300 mg/L of drinking water). We performed 2D-gel analyses of samples, considering differences in spleen, exposure levels, sex, and ages. Results: From proteomic analyses, we found various proteins were up- or down-regulated by BPA. Among them, SET, a putative oncogene and inhibitor of phosphatase 2A, was significantly down-regulated in a BPA dose-dependent manner. We also confirmed down-regulation of SET in western blot and real time PCR analyses. From gene network analysis, SET is predicted to communicate with other genes including CYP17, which is involved in biosynthesis and metabolism of sex-hormones. Conclusions: This study provided evidence that SET can be applied as a new biomarker for prenatal BPA exposure and suggests a potential new mechanism of action in that BPA may disrupt CYP17 via SET.
Kim, Doc-Kyu;Park, Yon-Kyoung;Lee, Jong-Suk;F. Kim, Ji-Hyun;Jeong, Hae-Young;Kim, Beom-Seok;Lee, Choong-Hwan
Journal of Microbiology and Biotechnology
/
제16권12호
/
pp.1912-1918
/
2006
Marine bacterium Hahella chejuensis KCTC 2396 simultaneously produced red antibiotic prodigiosin and undecylprodiginine. A complete set of the prodigiosin biosynthetic gene cluster has been cloned, sequenced, and successfully expressed in a heterologous host. Sequence analysis of the gene cluster revealed 14 ORFs showing high similarity to pig and red genes from Serratia spp. and Streptomyces coelicolor A3(2), respectively, and the gene organization was almost: similar to that of pig genes. These genes were named hap for Hahella prodigiosin, and determined to be transcribed as a single operon, by RT-PCR experiment. Based on the hap gene mutagenesis experiments and comparative analysis with pig and red genes, we propose a prodigiosin-biosynthetic pathway in KCTC 2396.
The pseudodisaccharide salbostatin, which consists of valienamine linked to 2-amino-1,5-anhydro-2-deoxyglucitol, is a strong trehalase inhibitor. From our Streptomyces albus ATCC 21838 genomic library, we identified thirty-two ORFs in a 37-kb gene cluster. Twenty-one genes are supposed to be a complete set of modules responsible for the salbostatin biosynthesis. Through sequence analysis of the gene cluster, some of the upstream gene products (SalB, SalC, SalD, SalE, and SalF) revealed functional resemblance with trehalose biosynthetic enzymes. On the basis of this rationale, we isolated the five genes (salB, salC, salD, salE, and salF) from the S. albus ATCC 21838 and cloned them into the expression vector pWHM3. We demonstrated the noticeable expression and accumulation of trehalose, using only the five upstream biosynthetic gene cluster of salbostatin, in the transformed Streptomyces lividans TK24. Finally, 490 mg/l trehalose was produced by fermentation of the transformant with sucrosedepleted R2YE media.
The polymerase chain reaction (PCR) amplification technique was used for comparison of Listeria monocytogenes serotypes. PCR primers for the fragment of invasion-associated protein (iap) gene were highly specific for all the serotypes of L. monocytogenes. Other Listeria spp., such as Listeria ivanovii and Listeria innocua were not produced the PCR fragments by above primer set. The nucleotide sequences of PCR products showed high homologies in comparison of all the isolated serotypes except unknown type II-2. The deduced amino acid sequences of the PCR products also showed similar to one another. The various region of the PCR products, called a Thr-Asn repeat region was presented. All of isolated L. monocytogenes serotypes possessed 16 to 20 Thr-Asn repeats.
For some basic information in tobacco breeding, the modes of inheritance and heritabilities for the twelve agronomic and chemical characters were estimated in the study of eight varieties partial diallel set. Additive gene actions were significant for all characters except total nitrogen content and dominance gene effects were also significant for all characters. Yield, number of leaves per plant, leaf length and leaf shape index were inherited as partial dominance, and overdominance was detected for plant height, stem diameter, internode length, total alkaloid, total nitrogen and total sugar content. Dominant gene showed increasing effects in yield, plant height, stem diameter, internode length, leaf width and total sugar content, but showed decreasing effects in the other characters. The broad heritability was very high for all characters. and the narrow heritability was high in days to flower and yield, but low in internode length, total alkaloid, total nitrogen and total sugar content.
Since hot peppers (Capsicum annuum L.) are getting reputation as an important source of vitamins, medicine and many other areas, consumption and cultivation is being increased in the world. In spite of this usefulness, so little attention has been given to the hot pepper plants. To date, less than 500 nucleotide sequences including redundancy has been identified in NCBI database. Therefore we started to EST sequencing project for initial characterization of the genome, because of the large genome size of hot pepper (2.7 3.3 ${\times}$ 109 bp), To date, a set of 10,000 non-redundant genes were identified by EST sequencing for microarray-based gene expression studies. At present, cDNA microarrays containing 4,685 unigene clones are used for hybridization labeled targets derived from pathogen infected and uninoculated leaf tissues. Monitoring of gene expression profiles of hot pepper interactions with soybean pustule pathogen (Xag;Xanthomonas axonopodis pv. glycine) will be presented.
Plant biotechnology involving genetic modification has been rather controversial. However, the major issues related to safety are being addressed by continued improvements in technology. Some of the related facts will be highlighted to set the tone for a scientific discussion on the possibilities of using the technology for crop improvement. Our main research interest is to understand the molecular regulation of shoot bud regeneration in plant tissue culture, which is essential for crop improvement by biotechnology. We have isolated and characterized some genes that are associated with adventitious shoot regeneration. These include a MADS-box cDNA (PkMADS1) from paulownia kawakamii, which regulates vegetative shoot development and in vitro shoot regeneration from leaf explants. Another gene we have characterized from petunia codesfor a cytokinin binding protein (PETCBP). Preliminary functional analysis of this gene indicated that this also affects adventitious shoot bud initiation. Also, the antisense suppression of this gene in petunia causedexcessive branching. Results from our work and selected other publications will be used to highlight the possibilities of manipulation of such genes to improve crop species.
Cell phenotypes are determined by groups of functionally related genes. Microarray profiling of gene expression provides us response of cellular state to its perturbation. Several methods for uncovering a cellular network show reliable network reconstruction. In this study, we present reconstruction of genetic regulatory network of inflammation bowel disease in human peripheral blood mononuclear cell. The microarray based on Affymetrix Gene Chip Human Genome U133 Array Set HG-U133A is processed and applied network reconstruction algorithm, ARACNe. As a result, we will show that inferred network composed of 450 nodes and 2017 edges is roughly scale-free network and hierarchical organization. The major hub, CCNL2 (cyclin A2), in inferred network is shown to be associated with inflammatory function as well as apoptotic function.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.