• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국통계학회:학술대회논문집
• /
• 한국통계학회 2003년도 추계 학술발표회 논문집
• /
• pp.173-177
• /
• 2003

When we have both a paired data set and two independent data sets, neither a paired t-test nor a two-sample t-test can be used to detect differences between two samples. In order to identify differentially expressed genes in a mixed data set, a new test statistic is proposed.

• Asian Pacific Journal of Cancer Prevention
• /
• 제13권6호
• /
• pp.2711-2715
• /
• 2012

Background: Bisphenol A (BPA), an endocrine disrupting chemical, has been suspected to pose carcinogenic risks. However, likely mechanisms are obscure and there are difficulties to estimating its real significance for cancer development. Methods: We therefore studied BPA-induced proteomic alterations in immune organs of ICR mice offspring that were prenatally exposed to BPA (15 and 300 mg/L of drinking water). We performed 2D-gel analyses of samples, considering differences in spleen, exposure levels, sex, and ages. Results: From proteomic analyses, we found various proteins were up- or down-regulated by BPA. Among them, SET, a putative oncogene and inhibitor of phosphatase 2A, was significantly down-regulated in a BPA dose-dependent manner. We also confirmed down-regulation of SET in western blot and real time PCR analyses. From gene network analysis, SET is predicted to communicate with other genes including CYP17, which is involved in biosynthesis and metabolism of sex-hormones. Conclusions: This study provided evidence that SET can be applied as a new biomarker for prenatal BPA exposure and suggests a potential new mechanism of action in that BPA may disrupt CYP17 via SET.

• Journal of Microbiology and Biotechnology
• /
• 제16권12호
• /
• pp.1912-1918
• /
• 2006

Marine bacterium Hahella chejuensis KCTC 2396 simultaneously produced red antibiotic prodigiosin and undecylprodiginine. A complete set of the prodigiosin biosynthetic gene cluster has been cloned, sequenced, and successfully expressed in a heterologous host. Sequence analysis of the gene cluster revealed 14 ORFs showing high similarity to pig and red genes from Serratia spp. and Streptomyces coelicolor A3(2), respectively, and the gene organization was almost: similar to that of pig genes. These genes were named hap for Hahella prodigiosin, and determined to be transcribed as a single operon, by RT-PCR experiment. Based on the hap gene mutagenesis experiments and comparative analysis with pig and red genes, we propose a prodigiosin-biosynthetic pathway in KCTC 2396.

• Journal of Microbiology and Biotechnology
• /
• 제17권10호
• /
• pp.1675-1681
• /
• 2007

The pseudodisaccharide salbostatin, which consists of valienamine linked to 2-amino-1,5-anhydro-2-deoxyglucitol, is a strong trehalase inhibitor. From our Streptomyces albus ATCC 21838 genomic library, we identified thirty-two ORFs in a 37-kb gene cluster. Twenty-one genes are supposed to be a complete set of modules responsible for the salbostatin biosynthesis. Through sequence analysis of the gene cluster, some of the upstream gene products (SalB, SalC, SalD, SalE, and SalF) revealed functional resemblance with trehalose biosynthetic enzymes. On the basis of this rationale, we isolated the five genes (salB, salC, salD, salE, and salF) from the S. albus ATCC 21838 and cloned them into the expression vector pWHM3. We demonstrated the noticeable expression and accumulation of trehalose, using only the five upstream biosynthetic gene cluster of salbostatin, in the transformed Streptomyces lividans TK24. Finally, 490 mg/l trehalose was produced by fermentation of the transformant with sucrosedepleted R2YE media.

• Fisheries and Aquatic Sciences
• /
• 제5권1호
• /
• pp.54-58
• /
• 2002

The polymerase chain reaction (PCR) amplification technique was used for comparison of Listeria monocytogenes serotypes. PCR primers for the fragment of invasion-associated protein (iap) gene were highly specific for all the serotypes of L. monocytogenes. Other Listeria spp., such as Listeria ivanovii and Listeria innocua were not produced the PCR fragments by above primer set. The nucleotide sequences of PCR products showed high homologies in comparison of all the isolated serotypes except unknown type II-2. The deduced amino acid sequences of the PCR products also showed similar to one another. The various region of the PCR products, called a Thr-Asn repeat region was presented. All of isolated L. monocytogenes serotypes possessed 16 to 20 Thr-Asn repeats.

• 한국연초학회지
• /
• 제9권1호
• /
• pp.45-55
• /
• 1987

For some basic information in tobacco breeding, the modes of inheritance and heritabilities for the twelve agronomic and chemical characters were estimated in the study of eight varieties partial diallel set. Additive gene actions were significant for all characters except total nitrogen content and dominance gene effects were also significant for all characters. Yield, number of leaves per plant, leaf length and leaf shape index were inherited as partial dominance, and overdominance was detected for plant height, stem diameter, internode length, total alkaloid, total nitrogen and total sugar content. Dominant gene showed increasing effects in yield, plant height, stem diameter, internode length, leaf width and total sugar content, but showed decreasing effects in the other characters. The broad heritability was very high for all characters. and the narrow heritability was high in days to flower and yield, but low in internode length, total alkaloid, total nitrogen and total sugar content.

• 한국식물병리학회:학술대회논문집
• /
• 한국식물병리학회 2003년도 정기총회 및 추계학술발표회
• /
• pp.80.2-81
• /
• 2003

Since hot peppers (Capsicum annuum L.) are getting reputation as an important source of vitamins, medicine and many other areas, consumption and cultivation is being increased in the world. In spite of this usefulness, so little attention has been given to the hot pepper plants. To date, less than 500 nucleotide sequences including redundancy has been identified in NCBI database. Therefore we started to EST sequencing project for initial characterization of the genome, because of the large genome size of hot pepper (2.7 3.3 ${\times}$ 109 bp), To date, a set of 10,000 non-redundant genes were identified by EST sequencing for microarray-based gene expression studies. At present, cDNA microarrays containing 4,685 unigene clones are used for hybridization labeled targets derived from pathogen infected and uninoculated leaf tissues. Monitoring of gene expression profiles of hot pepper interactions with soybean pustule pathogen (Xag；Xanthomonas axonopodis pv. glycine) will be presented.

• 한국식물생명공학회:학술대회논문집
• /
• 한국식물생명공학회 2005년도 춘계학술대회 및 국제심포지움 초록집
• /
• pp.6-9
• /
• 2005

Plant biotechnology involving genetic modification has been rather controversial. However, the major issues related to safety are being addressed by continued improvements in technology. Some of the related facts will be highlighted to set the tone for a scientific discussion on the possibilities of using the technology for crop improvement. Our main research interest is to understand the molecular regulation of shoot bud regeneration in plant tissue culture, which is essential for crop improvement by biotechnology. We have isolated and characterized some genes that are associated with adventitious shoot regeneration. These include a MADS-box cDNA (PkMADS1) from paulownia kawakamii, which regulates vegetative shoot development and in vitro shoot regeneration from leaf explants. Another gene we have characterized from petunia codesfor a cytokinin binding protein (PETCBP). Preliminary functional analysis of this gene indicated that this also affects adventitious shoot bud initiation. Also, the antisense suppression of this gene in petunia causedexcessive branching. Results from our work and selected other publications will be used to highlight the possibilities of manipulation of such genes to improve crop species.

• Bioinformatics and Biosystems
• /
• 제2권2호
• /
• pp.71-74
• /
• 2007

Cell phenotypes are determined by groups of functionally related genes. Microarray profiling of gene expression provides us response of cellular state to its perturbation. Several methods for uncovering a cellular network show reliable network reconstruction. In this study, we present reconstruction of genetic regulatory network of inflammation bowel disease in human peripheral blood mononuclear cell. The microarray based on Affymetrix Gene Chip Human Genome U133 Array Set HG-U133A is processed and applied network reconstruction algorithm, ARACNe. As a result, we will show that inferred network composed of 450 nodes and 2017 edges is roughly scale-free network and hierarchical organization. The major hub, CCNL2 (cyclin A2), in inferred network is shown to be associated with inflammatory function as well as apoptotic function.