• 제목/요약/키워드: consensus sequences

검색결과 119건 처리시간 0.025초

미꾸라지의 복제원점에 대한 특성 및 구조 분석 (Characterization and DNA Structure Analysis of Replication Origin of Misgurnus mizolepis)

  • 임학섭;김무상;석영선;박상대;이형호
    • 한국양식학회지
    • /
    • 제9권1호
    • /
    • pp.93-100
    • /
    • 1996
  • 물고기에서 효과적인 발현 vector의 구성을 위해, 미꾸라지 MAR로부터 ARS를 cloning하여, 그 염기서열을 분석하였다. 총 443 염기들로 구성된 미꾸라지의 ARS는 다른 여러종들의 DNA 복제원점에서 나타나는 것 처럼, AT가 풍부하고, ARS consensus sequences, topoi-somerase II consensus sequences, 그리고 A 흑은 T-box등을 포함하고 있다. 그리고 그 DNA 단편은 복제원점에서 일반적인 양상으로 나타나는 반복적인 inverted sequence들을 가지고 있고, 5개의 가능한 hairpin loop 구조들을 내포하고 있다. 이들 구조는 DNA 복제개시에 관여하는 단백질들의 인지부위로 작용할 것으로 생각된다.

  • PDF

대용량 순차 데이터베이스에서 근사 순차패턴 탐색 (Mining Approximate Sequential Patterns in a Large Sequence Database)

  • 금혜정;장중혁
    • 정보처리학회논문지D
    • /
    • 제13D권2호
    • /
    • pp.199-206
    • /
    • 2006
  • 순차패턴 탐색은 다양한 응용 분야에서 매우 중요한 데이터 마이닝 작업으로 간주된다. 그러나 기존의 순차패턴 탐색 방법들은 길이가 긴 순차패턴이나 노이즈 정보를 다수 포함한 데이터베이스에 대한 마이닝에서는 한계가 있다. 해당 방법들은 매우 짧고 사소한 패턴들은 탐색하지만 다수의 순차 정보들에서 공유되는 중요 패턴들을 분석하는데 어려움을 겪는다. 본 논문에서는 이러한 문제를 해결하기 위한 방법으로 대용량 데이터베이스에 대한 근사 순차패턴 탐색 방법을 제안한다. 근사 순차패턴은 다수의 순차 정보들에서 근사적으로 공유되는 순차패턴을 의미한다. 제안된 방법은 두 과정으로 구분된다. 하나는 유사도에 따라 분석 대상 순차 정보들을 몇 개의 군집으로 나누는 과정이며, 다른 하나는 다중 정렬 방식을 적용하여 각 군집으로부터 대표 패턴을 찾는 과정이다. 이를 위해서 다수의 순차 정보들을 하나로 표현할 수 있는 가중치 순차패턴을 제시하며, 다수의 순차 정보들은 가중치 순차패턴 형태로 통합된다. 이렇게 통합된 정보를 가진 각 가중치 순차패턴을 이용하여 여러 순차 정보와 근사한 하나의 대표 패턴을 생성한다. 끝으로, 다양한 실험을 통해서 제안된 방법의 유용성을 검증한다.

DNA 염기 서열의 단편 조립 프로그램 개발

  • 이병욱;박기정;박완;박용하
    • 한국미생물·생명공학회지
    • /
    • 제25권6호
    • /
    • pp.560-565
    • /
    • 1997
  • DNA fragment assembly is a major concem in shot-gun DNA sequencing project. It is to reconstruct a consensus DNA sequence from a collection of random oritented fragments. We developed a computer program that is useful for DNA fragment assembly. Inputs to the program are DNA fragment sequences including IUB-IUPAC bases. The program produces the most probable reconstruction ot the original DNA sequence as a text format or a PostScript format. The program consists of four phases: the first phase quickly eliminates fragment pairs that can not possibly overlap. In the second phase, the quality of overlap between each pair is calculated to a score. In the third phase, overlap pairs are sorted by their scores and consistency of the overlaps is checked. The last phase determines consensus sequences and displays them. The performance of fragment assembly program was tested on a set of DNA fragment sequences which were generated from long DNA sequences of GenBank by a fragmentation program.

  • PDF

Aspergillus nidulans의 tRNA 유전자의 구조와 발현에 관한 연구 VI

  • 이병재;강현삼
    • 미생물학회지
    • /
    • 제24권3호
    • /
    • pp.204-210
    • /
    • 1986
  • One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

  • PDF

Identification of Bacteriophage K11 Genomic Promoters for K11 RNA Polymerase

  • Han, Kyung-Goo;Kim, Dong-Hee;Junn, Eun-Sung;Lee, Sang-Soo;Kang, Chang-Won
    • BMB Reports
    • /
    • 제35권6호
    • /
    • pp.637-641
    • /
    • 2002
  • Only one natural promoter that interacts with bacteriophage K11 RNA polymerase has so far been identified. To identify more, in the present study restriction fragments of the phage genome were individually assayed for transcription activity in vitro. The K11 genome was digested with two 4-bp-recognizing restriction enzymes, and the fragments cloned in pUC119 were assayed with purified K11 RNA polymerase. Eight K11 promoter-bearing fragments were isolated and sequenced. We report that the nine K11 promoter sequences (including the one previously identified) were highly homologous from -17 to +4, relative to the initiation site at +1. Interestingly, five had -10G and -8A, while the other four had -10A and -8C. The consensus sequences with the natural -10G/-8A and -10A/-8C, and their variants with -10G/-8C and -10A/-8A, showed nearly equal transcription activity, suggesting residues at -10 and -8 do not regulate promoter activity. Using hybridization methods, physical positions of the cloned promoter-bearing sequences were mapped on SalI-and KpnI-restriction maps of the K11 genome. The flanking sequences of six cloned K11 promoters were found to be orthologous with T7 or T3 genomic sequences.

Functional analysis of expressed sequence tags from the liver and brain of Korean Jindo dogs

  • Kim, Jae-Young;Park, Hye-Sun;Lim, Da-Jeong;Jang, Hong-Chul;Park, Hae-Suk;Lee, Kyung-Tai;Kim, Jong-Seok;Oh, Seok-Il;Kweon, Mu-Sik;Kim, Tae-Hun;Choi, Bong-Hwan
    • BMB Reports
    • /
    • 제44권4호
    • /
    • pp.238-243
    • /
    • 2011
  • We generated 16,993 expressed sequence tags (ESTs) from two libraries containing full-length cDNAs from the brain and liver of the Korean Jindo dog. An additional 365,909 ESTs from other dog breeds were identified from the NCBI dbEST database, and all ESTs were clustered into 28,514 consensus sequences using StackPack. We selected the 7,305 consensus sequences that could be assembled from at least five ESTs and estimated that 12,533 high-quality single nucleotide polymorphisms (SNPs) were present in 97,835 putative SNPs from the 7,305 consensus sequences. We identified 58 Jindo dog-specific SNPs in comparison to other breeds and predicted seven synonymous SNPs and ten non-synonymous SNPs. Using PolyPhen, a program that predicts changes in protein structure and potential effects on protein function caused by amino acid substitutions, three of the non-synonymous SNPs were predicted to result in changes in protein function for proteins expressed by three different genes (TUSC3, ITIH2, and NAT2).

Characterization in Terms of the NUX Rule of G-inserted Mutant Hammerhead Ribozymes with High Level of Catalytic Power

  • Kuwabara, Tomoko;Warashina, Masaki;Kato, Yoshio;Kawasaki, Hiroaki;Taira, Kazunari
    • BMB Reports
    • /
    • 제34권1호
    • /
    • pp.51-58
    • /
    • 2001
  • Attempts using in vitro and in vivo selection procedures have been made to search for hammerhead ribozymes that have higher activities than the wild-type ribozyme and also to determine whether other sequences might be possible in the catalytic core of the hammerhead ribozyme. Active sequences selected in the past conformed broadly to the consensus core sequence except at A9, and no sequences were associated with higher activity than that of the hammerhead with the consensus core, an indication that the consensus sequence derived from viruses and virusoids is probably the optimal sequence [Vaish et al. (1997) Biochemistry 36, 6495-6501]. Recently, during construction of ribozyme expression vectors, we isolated a mutant hammerhead ribozyme, with an insertion of G between A9 and G10.1, that appeared to show significant activity [Kawasaki et al. (1996) Nucleic Acids Res. 24, 3010-3016; Kawasaki et al. (1998) Nature 393, 284-289]. We, therefore, characterized kinetic properties of the G-inserted mutant ribozymes in terms of the NUX rule. We demonstrate that the NUX rule is basically applicable to the G-inserted ribozymes and, more importantly, one type of G-inserted ribozyme was very active with $k_{cat}$, value of $6.4\;min^{-1}$ in 50 mM Tris-HCl (pH 8.0) and 10 mM $MgCl_2$ at $37^{\circ}C$.

  • PDF

은어, Plecoglossus altivelis 난소에서 발현하는 Connexin 35 cDNA의 해석 (Molecular Cloning and Nucleotide Sequence of Connexin 35 cDNA in the Ovary from the Sweetfish, Plecoglossus altivelis)

  • 최철영;장영진
    • 한국수산과학회지
    • /
    • 제33권6호
    • /
    • pp.565-571
    • /
    • 2000
  • 기존의 Cx 배열을 참고로 종내${cdot}$종간을 통하여 잘 보존되어져 있는 영역에서 primer를 설계하고, 은어의 난소를 재료로 하여 PCR을 실시하였다. 증폭된 cDNA 단편을 이용하여, 5'RACE 및 3'RACE법에 의해 미지의 영역을 cloning하여 난소에서 발현하는 Cx cDNA의 전염기배열을 결정하였다. 기존의 Cx 배열과 상동성을 비교한 결과, 대서양산 민어의 Cx32.7과 $63.8{\%}$, bovine의 Cx44와 $61.6{\%}$ 및 대서양산 민어의 Cx32.2와는 $56.7{\%}$의 상동성이 나타났다. 본 cDNA는 35,028 Da의 분자량을 code하는 open reading frame (ORF)으로 구성되어 있어, 은어 Cx35로 명명되었다. 또한 아미노산 배열의 친수성${\cdot}$소수성 영역의 분포예측 결과, 4곳의 소수성 영역과 4곳의 친수성 영역을 교차하는 전형적인 Cx의 구조와 일치하였으며, Cx family의 공통${\cdot}$필수적인 배열인 제1세포외 domain의 consensus 배열 및 제2세포외 domain의 consensus 배열도 존재하였다.

  • PDF

Sequence Selectivity of DNA Alkylation by Adozelesin and Carzelesin

  • Yoon, Jung-Hoon;Lee, Chong-Soon
    • Archives of Pharmacal Research
    • /
    • 제21권4호
    • /
    • pp.385-390
    • /
    • 1998
  • Adozelesin and carzelesin are synthetic analogues of the extremely potent antitumor antibiotic CC-1065, which alkylates N3 of adenine in a consensus sequence $5^1$-(A/T)(A/T)$A^*$ ($A^*$ is the site of alkylation). We have investigated the DNA sequence selectivity of adozelesin and carzelesin by thermally ind ced DNA strand cleavage assay using radiolabeled restriction DNA fragments. An analysis of alkylation patterns shows that the consensus sequences for carzelesin and adozelesin have been found to be $5^1$-(A/T)(A/T)$A^*$ and $5^1$-(A/F)(G/C)(A/T)$A^*$. A new consensus sequence, $5^1$-(A/T)(A/T)$CA^*$, has been observed to display an additional alkylation site for adozelesin but not for carzelesin. These results indicate that the pattern of sequence selectivity induced by carzelesin is similar but not identical to those induced by adozelosin.

  • PDF

Hierarchical Graph Based Segmentation and Consensus based Human Tracking Technique

  • Ramachandra, Sunitha Madasi;Jayanna, Haradagere Siddaramaiah;Ramegowda, Ramegowda
    • Journal of Information Processing Systems
    • /
    • 제15권1호
    • /
    • pp.67-90
    • /
    • 2019
  • Accurate detection, tracking and analysis of human movement using robots and other visual surveillance systems is still a challenge. Efforts are on to make the system robust against constraints such as variation in shape, size, pose and occlusion. Traditional methods of detection used the sliding window approach which involved scanning of various sizes of windows across an image. This paper concentrates on employing a state-of-the-art, hierarchical graph based method for segmentation. It has two stages: part level segmentation for color-consistent segments and object level segmentation for category-consistent regions. The tracking phase is achieved by employing SIFT keypoint descriptor based technique in a combined matching and tracking scheme with validation phase. Localization of human region in each frame is performed by keypoints by casting votes for the center of the human detected region. As it is difficult to avoid incorrect keypoints, a consensus-based framework is used to detect voting behavior. The designed methodology is tested on the video sequences having 3 to 4 persons.