• Journal of Aquaculture
• /
• v.9 no.1
• /
• pp.93-100
• /
• 1996

Previously, as an effort to make an autonomously replicating expression vector in fish, an ARS (autonomously replicating sequence) was cloned from MAR (matrix attachment region) of Misgurnus mizolepis. The DNA fragment composed of 443 base pairs contains ARS core consensus sequences, topoisomerase II consensus sequences, and A or T box sequences which are homologous to the known consensus sequences originated from other organisms. The clond ARS, as other DNA replication origins, contains inverted repeat sequences and several potential hairpin loop structures. These consensus sequences and hairpin structures may serve as recognition signals for regulatory proteins of DNA replication initiation.

• The KIPS Transactions:PartD
• /
• v.13D no.2 s.105
• /
• pp.199-206
• /
• 2006

Sequential pattern mining is an important data mining task with broad applications. However, conventional methods may meet inherent difficulties in mining databases with long sequences and noise. They may generate a huge number of short and trivial patterns but fail to find interesting patterns shared by many sequences. In this paper, to overcome these problems, we propose the theme of approximate sequential pattern mining roughly defined as identifying patterns approximately shared by many sequences. The proposed method works in two steps: one is to cluster target sequences by their similarities and the other is to find consensus patterns that ire similar to the sequences in each cluster directly through multiple alignment. For this purpose, a novel structure called weighted sequence is presented to compress the alignment result, and the longest consensus pattern that represents each cluster is generated from its weighted sequence. Finally, the effectiveness of the proposed method is verified by a set of experiments.

• Microbiology and Biotechnology Letters
• /
• v.25 no.6
• /
• pp.560-565
• /
• 1997

DNA fragment assembly is a major concem in shot-gun DNA sequencing project. It is to reconstruct a consensus DNA sequence from a collection of random oritented fragments. We developed a computer program that is useful for DNA fragment assembly. Inputs to the program are DNA fragment sequences including IUB-IUPAC bases. The program produces the most probable reconstruction ot the original DNA sequence as a text format or a PostScript format. The program consists of four phases: the first phase quickly eliminates fragment pairs that can not possibly overlap. In the second phase, the quality of overlap between each pair is calculated to a score. In the third phase, overlap pairs are sorted by their scores and consistency of the overlaps is checked. The last phase determines consensus sequences and displays them. The performance of fragment assembly program was tested on a set of DNA fragment sequences which were generated from long DNA sequences of GenBank by a fragmentation program.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• BMB Reports
• /
• v.35 no.6
• /
• pp.637-641
• /
• 2002

Only one natural promoter that interacts with bacteriophage K11 RNA polymerase has so far been identified. To identify more, in the present study restriction fragments of the phage genome were individually assayed for transcription activity in vitro. The K11 genome was digested with two 4-bp-recognizing restriction enzymes, and the fragments cloned in pUC119 were assayed with purified K11 RNA polymerase. Eight K11 promoter-bearing fragments were isolated and sequenced. We report that the nine K11 promoter sequences (including the one previously identified) were highly homologous from -17 to +4, relative to the initiation site at +1. Interestingly, five had -10G and -8A, while the other four had -10A and -8C. The consensus sequences with the natural -10G/-8A and -10A/-8C, and their variants with -10G/-8C and -10A/-8A, showed nearly equal transcription activity, suggesting residues at -10 and -8 do not regulate promoter activity. Using hybridization methods, physical positions of the cloned promoter-bearing sequences were mapped on SalI-and KpnI-restriction maps of the K11 genome. The flanking sequences of six cloned K11 promoters were found to be orthologous with T7 or T3 genomic sequences.

• BMB Reports
• /
• v.44 no.4
• /
• pp.238-243
• /
• 2011

We generated 16,993 expressed sequence tags (ESTs) from two libraries containing full-length cDNAs from the brain and liver of the Korean Jindo dog. An additional 365,909 ESTs from other dog breeds were identified from the NCBI dbEST database, and all ESTs were clustered into 28,514 consensus sequences using StackPack. We selected the 7,305 consensus sequences that could be assembled from at least five ESTs and estimated that 12,533 high-quality single nucleotide polymorphisms (SNPs) were present in 97,835 putative SNPs from the 7,305 consensus sequences. We identified 58 Jindo dog-specific SNPs in comparison to other breeds and predicted seven synonymous SNPs and ten non-synonymous SNPs. Using PolyPhen, a program that predicts changes in protein structure and potential effects on protein function caused by amino acid substitutions, three of the non-synonymous SNPs were predicted to result in changes in protein function for proteins expressed by three different genes (TUSC3, ITIH2, and NAT2).

• BMB Reports
• /
• v.34 no.1
• /
• pp.51-58
• /
• 2001

Attempts using in vitro and in vivo selection procedures have been made to search for hammerhead ribozymes that have higher activities than the wild-type ribozyme and also to determine whether other sequences might be possible in the catalytic core of the hammerhead ribozyme. Active sequences selected in the past conformed broadly to the consensus core sequence except at A9, and no sequences were associated with higher activity than that of the hammerhead with the consensus core, an indication that the consensus sequence derived from viruses and virusoids is probably the optimal sequence [Vaish et al. (1997) Biochemistry 36, 6495-6501]. Recently, during construction of ribozyme expression vectors, we isolated a mutant hammerhead ribozyme, with an insertion of G between A9 and G10.1, that appeared to show significant activity [Kawasaki et al. (1996) Nucleic Acids Res. 24, 3010-3016; Kawasaki et al. (1998) Nature 393, 284-289]. We, therefore, characterized kinetic properties of the G-inserted mutant ribozymes in terms of the NUX rule. We demonstrate that the NUX rule is basically applicable to the G-inserted ribozymes and, more importantly, one type of G-inserted ribozyme was very active with $k_{cat}$, value of $6.4\;min^{-1}$ in 50 mM Tris-HCl (pH 8.0) and 10 mM $MgCl_2$ at $37^{\circ}C$.

• Korean Journal of Fisheries and Aquatic Sciences
• /
• v.33 no.6
• /
• pp.565-571
• /
• 2000

Mixed primers based on the high sequence homology of selected regions of known connexins (Cxs) was used for PCR reaction. A full-length connexin cDNA of sweetfish (Plecoglossus altivelis) was cloned by rapid amplification of cDNA 5'and (5'RACE) and 3'RACE method. When compared to other known Cx sequences, homology of sweetfish Cx cDNA to Atlantic croaker, Mycropogonias undulatus Cx32.7, bovine, Bos taurus Cx44 and Atlantic croaker Cx32.2 were $63.8{\%},\;61.6{\%}\;and\;56.7{\%}$, respectively. This cDNA encoded 308 amino acids (35,028 dalton) and named as sweetfish Cx35. Hydropathicity analysis of predicted amino acid sequences indicated that sweetfish Cx35 have four major hydrophobic regions and four major hydrophilic regions, suggesting its topology is similar to that of known Cxs. The presence of a tfical Cx consensus sequences were identified in each of the extracellular loops (first loop and second loop).

• Archives of Pharmacal Research
• /
• v.21 no.4
• /
• pp.385-390
• /
• 1998

Adozelesin and carzelesin are synthetic analogues of the extremely potent antitumor antibiotic CC-1065, which alkylates N3 of adenine in a consensus sequence $5^1$-(A/T)(A/T)$A^*$ ($A^*$ is the site of alkylation). We have investigated the DNA sequence selectivity of adozelesin and carzelesin by thermally ind ced DNA strand cleavage assay using radiolabeled restriction DNA fragments. An analysis of alkylation patterns shows that the consensus sequences for carzelesin and adozelesin have been found to be $5^1$-(A/T)(A/T)$A^*$ and $5^1$-(A/F)(G/C)(A/T)$A^*$. A new consensus sequence, $5^1$-(A/T)(A/T)$CA^*$, has been observed to display an additional alkylation site for adozelesin but not for carzelesin. These results indicate that the pattern of sequence selectivity induced by carzelesin is similar but not identical to those induced by adozelosin.

• Journal of Information Processing Systems
• /
• v.15 no.1
• /
• pp.67-90
• /
• 2019

Accurate detection, tracking and analysis of human movement using robots and other visual surveillance systems is still a challenge. Efforts are on to make the system robust against constraints such as variation in shape, size, pose and occlusion. Traditional methods of detection used the sliding window approach which involved scanning of various sizes of windows across an image. This paper concentrates on employing a state-of-the-art, hierarchical graph based method for segmentation. It has two stages: part level segmentation for color-consistent segments and object level segmentation for category-consistent regions. The tracking phase is achieved by employing SIFT keypoint descriptor based technique in a combined matching and tracking scheme with validation phase. Localization of human region in each frame is performed by keypoints by casting votes for the center of the human detected region. As it is difficult to avoid incorrect keypoints, a consensus-based framework is used to detect voting behavior. The designed methodology is tested on the video sequences having 3 to 4 persons.