• Research in Plant Disease
• /
• v.15 no.2
• /
• pp.106-111
• /
• 2009

Before transplanting Chinese cabbage seedlings, two kinds of eggshell powder were blended into the soil of cabbage field where the club root pathogen, Plasmodiophora brassicae, was infested. The incidence of clubroot disease, the shoot and root growth of cabbages, and soil pH were examined four times at 10 to 13 days interval from transplanting Chinese cabbage. As results, the cabbages treated with eggshell powder without membrane showed the fastest growth in above ground part, and the lowest disease index for clubroot disease. The cabbages treated with eggshell powder with membrane showed better growth than the cabbages of non-treated check, but lower growth than those treated with eggshell powder without membrane. Soil pH started to increase from 3 weeks after soil blending of eggshell powder, and it reached to above 8.0. However, the soil pH of non-treated check stayed at around 6.8. In the experiment to compare the effect of eggshell powder with other calcium compounds, soil-blending of $CaCO_3$ resulted the lowest disease incidence of 1.7 and the registered fungicide, 'flusulfamide', and the resistant variety 'CR Green cabbage' followed with the incidence of 1.9. Cabbages of non-treated check scored the highest disease incidence, 3.4, and that of eggshell powder without membrane was as high as 2.7. However, the growth of Chinese cabbage showed the different pattern to the disease incidence. Chinese cabbages treated with eggshell without membrane recorded the highest average growth, around 2.1 kg. On the other hand, the average growth of CR Green Chinese cabbage was about 2.0 kg, that of flusulfamide-treatment plot was 1.7, and that of non-treated check was as low as 1.3 kg. Soil blending of eggshell powder without membrane did not inhibit the development of clubroot, but increased the growth of cabbage to a great extent. Therefore, it was confirmed that soil blending of eggshell powder before transplanting makes the Chinese cabbage culture possible even in the field infested with club root pathogen.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 한국균학회소식:학술대회논문집
• /
• 2015.05a
• /
• pp.23-23
• /
• 2015

Plasmodiophora brassicae is a major disease threat for Brassica oil and vegetable crop production worldwide. The causal agent is a Plasmodiophorid, which are obligate biotrophic plant-pathogenic protists in the Rhizarian kingdom. Although the Plasmodiophorids include other important agricultural pathogens such as Polymyxa betae, Spongospora subterranea, their biology remains poorly understood due to their intracellular biotrophic life style. I will present the assembled and annotated genome of P. brassicae, with insights into developmental stage-specific. We provide the first genomic data for pathogenic Rhizaria. The exploitation of the life stage specific transcripts will shed light in the understanding of the life cycle at a molecular basis, which will in the long run help to understand and control club root disease. Our data also fill an important gap for the understanding of the eukaryotic tree of life, since this is only the third genome of the eukaryotic kingdom of Rhizaria.

• Journal of Wetlands Research
• /
• v.8 no.3
• /
• pp.39-49
• /
• 2006

Seasonal biomass and carbon, nitrogen contents change of marsh club-rush (Schoenoplectus trigueter) was investigated in Nakdong river estuary, located near Busan, Korea. New shoot of S. trigueter sprouted from tuber in April and fast growth season was followed until mature in August. Mature lengths of shoot and root were 60 and 9.4 cm, respectively. The increase of biomass showed similar seasonal trends with length. Mature biomass were $3.5gind^{-1}$ in wet weight and $0.6gind^{-1}$ in dry weight. The biomass of S. trigueter in areal basis was also highest during July and August ($186gDWm^{-2}$). The shoot of S. trigueter was disappeared in October from the ground but the biomass of shoot was maintained as a form of detritus in sediment. The amount of S. trigueter detritus was about 30~50% of the biomass in August. During winter, the amount of detritus decreased with time but the biomass of root+tuber remained same, implying the root+tuber part is alive. The net productivity of S. trigueter estimated from biomass change were $538gDWm^{-2}yr^{-1}$, $240g-Cm^{-2}yr^{-1}$, $8.2g-Nm^{-2}yr^{-1}$ in dry weight, carbon and nitrogen equivalent respectively. During winter, carbon to nitrogen ratio in detritus increased implying the preferred remineralization of nitrogen during microbial degradation.

• Journal of the Korean Institute of Landscape Architecture
• /
• v.26 no.2
• /
• pp.54-61
• /
• 1998

The subsurface environment of the root zone area can set the stae for "do or die" of the turfgrass plant. The good condition of the greens is verified by their physical properties. Therefore, this study was carried to evaluate on the existing green of Hwasan C.C. by undisturbed soil Core Anaysis. We completed the ISTRC SYSTEM BenchMarking of the undisturbed core samples taken from Green #1, Green #5, Green #9-"Best" area, and Green #9-"Stressed" area for the Hwasan C.C.. It was also our understanding that the greens were in "good" to "very good" conditioni. THe exception might be Green #9-"Stress" area, which was the stressed area. The stressed area was confined to a ridge across Green #9. The organic content test results comfirmed the development of organic layering in depth 0-2.5cm. For the amount of compaction in the upper root zones and te development of the green's respective organic layers, the infiltration rates were high in Green #1, Green #5, and Green #9 "Stressed" area. The depicted aerificaton hole might be the probable cause of the relatively high infiltraton rate. Green #9-"Best" area had a tested infiltration rate of 18.75cm/hr. Either this area had not been aerified, or the undisturbed sample did not contain a aerification cavity. The water retention capacity of the undisturbed samples was good. When the greens were first constructed, the original root zone mix had been relatively low water retention properties. And the bulk density and the porosity of the undisturbed samples were good. In the result, all the greens were similar except for the infiltration. Thus, we supposed that Green #9-"Stressed" area might be ainly influenced by the amount of irrigation water and the configuration of the green's surface. There had been a reduction in the amount of irrigation water as the water retention capacity in the greens was promoted. Especially, it had gradually become more of a problem as the green had matured in Green #9-"Stressed" area. Because Green #9-"Stressed" area was a ridge area. The reduction in the amount of irrigation water might be the probable cause of the stress in Green #9-"Stressed" area. Our final observation related to the soil texture and the particle size distribution of the sand. Though and sand contant of all the tested greens were good, the gravel content of them exceeded ISTRC Guidelines. In particle size distribution of the sand, the very coarse and the coarse content of all the tested greens exceeded, but the rest was insufficient. The stability is a function of the material retained on the 0.25mm mesh screen. But, the content of all the tested greens was very insufficient. Though all the greens was serviceable, the coarse root zone sands, such as the sand in the tested greens, tended to be "unstable". Thus, we recommend using a topdressing/aerification sand which should be more in line with ISTRC/USGA Guidelines.;unstable". Thus, we recommend using a topdressing/aerification sand which should be more in line with ISTRC/USGA Guidelines.ines.

• Proceedings of the Korean Society of Plant Pathology Conference
• /
• 2003.10a
• /
• pp.92.2-93
• /
• 2003

Severe soybean-sprout rot was found at the mass productive factory in 2000 and 2001 and it caused 10-20％ loss of the production. Pythium sp. was isolated almost 90％ by potato dextrose agar from rotted root and hypocotylsof the sprouts. And the pathogencity tests using test tubes with 2％ water agar and small containers (30 ${\times}$ 30 ${\times}$ 50 cm, WxLxH) cultivation were shown a similar rot on roots and hypocotyls. The fungal mycelium grew rapidly on the water agar and it prevented the seed germination. Density of the Pythium sp. in the recycled water system at the factory was periodically measured using a selective medium, corn meal agar with Pimaricin 10 mg, Rifampicin 10 mg, Ampicillin 100 mg per 1 liter in order to check the contamination of recycled water. After fitering step using 5 and 1 ml in the recycled system was applied and it was effectively controlled Pythium rot. The daily yield of sprout was stable and the occurrenceof Pythium in the recycled water was much less after filtering. The fungal isolates were identified as Pythium deliense Meurs based on various mycological characteristics on corn meal agar and sucrose-asparagine bentgrass leaf culture medium. P. deliens oogonia were spherical, smooth, 19-23 urn in diameter, and their stalk bending toward antheridia. Antheridia were straw hat-shaped, curred club-shaped, therminal or intercalary, monoclinous, occasionally diclinous, 12∼15 ${\times}$ 8∼11 um, 1(∼2) per oogonium.

• Asian Journal of Turfgrass Science
• /
• v.25 no.2
• /
• pp.125-132
• /
• 2011

Drought is a major limiting factor in turfgrass management. Turfgrass responses to water deficit depend on the amount and the rate of water loss as well as the duration of the stress condition. This review paper was designed to understand responses such as photosynthesis, canopy spectral reflectance, plant cell, root, hormone and protein alteration when turfgrass got drought stress. Furthermore, mechanisms to recover from drought conditions were reviewed in detail. However, there are still many questions regarding plant adaptation to water deficit. It is not clear that the mechanism by which plants detect water deficit and transfer that signal into adaptive responses. Turfgrass research should focus on the best management practices such as how to enhance the ability of self-defense mechanism through understanding plant responses by environmental stress.

• Mycobiology
• /
• v.37 no.3
• /
• pp.225-229
• /
• 2009

Single spore isolates of Plasmodiophora brassicae e4 and e9 obtained from diseased Chinese cabbage were identified as race 4 and race 9, respectively, by the Williams' differential variety set. To confirm the possibility of variation in same generation and progeny of a single spore isolate of P. brassicae, random amplified polymorphic DNA (RAPD) analysis was conducted using the URP 3, 6 and OPA 7 primers. There was no difference in band type at each part of the gall of Chinese cabbage obtained by inoculation of e4 and e9 and amplification using the URP 3 and 6 primers when the same generation was analyzed. In addition, the progeny analysis, which was expanded to the third generation and conducted using the URP 3 and OPA 7 primers, revealed no differences in the band type of the e4 isolate. Based on these results, the single spore isolate of P. brassicae was genetically stable.

• Journal of the Korea Organic Resources Recycling Association
• /
• v.22 no.4
• /
• pp.54-61
• /
• 2014

This study was conducted to investigate the effect of Actinomyces sp. and Bacillus sp., United States granular microorganisms and Japan granular microorganisms on turfgrass growth and thatch decomposing of creeping bentgrass in golf course by measuring turf color index, chlorophyll index, thatch content of soil, root length, turf density and chemical properties and thatch content of soil. Fertilizer treatment was designed as follows; control(CF; compound fertilizer), microorganism medium(M; CF+M), microorganism medium and livestock manure fertilizer(M-L; CF+M+LMF), microorganism medium, livestock manure fertilizer and amino acid liquid fertilizer(M-L-A; MM+LMF+ALF), United States granular microorganisms(USGM; CF+USGM), Japan granular microorganisms(CF+JGM). Soil properties investigated after experiment was scarcely affected by applied fertilizers in root zone of creeping bentgrass. The turf color index and chlorophyll index of M, M-L, M-L-A, USGM, JGM treatment were higher than those of CF. The turfgrass root in M-L treatment was longer than others. The thatch content of soil in M treatment was longer than others. The thatch content of M was decreased than that of CF by 6.8%. These was suggested that application of M induced the development of quality and growth of creeping bentgrass by assisting turfgrass growth and thatch decomposing.

• Asian Journal of Turfgrass Science
• /
• v.23 no.1
• /
• pp.9-22
• /
• 2009

Due to increasing concerns over issues with both water quantity and quality for turfgrass use, research was conducted to determine the response of five warm-season turfgrasses to deficit irrigation and to gain a better understanding of relative drought tolerance. St. Augustinegrass(Stenotaphrum secundatum [Walt.] Kuntze.) cultivars 'Floratam' and 'Palmetto', 'SeaIsle 1' seashore Paspalum(Paspalum vaginatumSwartz.), 'Empire' zoysiagrass(Zoysia japonica Steud.), and 'Pensacola' bahiagrass(Paspalum notatum Flugge) were established in lysimeters in the University of Florida Envirotron greenhouse facility in Gainesville. Irrigation was applied at100%, 80%, 60%, or 40% of evapotranspiration(ET). Evaluations included: a) shoot quality, leaf rolling, leaf firing; b) leaf relative water content(RWC), soil moisture content, chlorophyll content index(CCI), canopy photosynthesis(PS); c) multispectral reflectance(MSR); d) root distribution; and e) water use efficiency. Grasses irrigated at 100% and 80% of ET had no differences in visual quality, leaf rolling, leaf firing, RWC, CCI, and PS. Grasses irrigated at 60% of ET had higher values in physiological aspects than grasses irrigated at 40% of ET. 'Sealsle 1' and 'Palmetto' had a deeper root system than 'Empire' and 'Pensacola', while 'Floratam' had the least amount of root mass. Photosynthesis was positively correlated with visual assessments such as turf quality, leaf rolling, leaf firing, and sensor-based measurements such as CCI, soil moisture, and MSR. Reducing the amount of applied water by 20% did not reduce turfgrass quality and maintained acceptable physiological functioning.