• Journal of Microbiology and Biotechnology
• /
• v.27 no.3
• /
• pp.535-541
• /
• 2017

Two Gram-staining-negative, red-pinkish, coccus-shaped, non-motile, and aerobic bacterial strains, designated $Ant21^T$ and Ant22, were isolated from the Antarctic coastal sea water. Strains $Ant21^T$ and Ant22 showed UVC and gamma radiation resistance. Phylogenetic analyses based on 16S rRNA gene sequences determined that these strains belong to the genus Deinococcus. Through the analyses of the 16S rRNA gene sequences, strains $Ant21^T$ and Ant22 were found to have 97.7% and 97.8% similarity to Deinococcus marmoris DSM $12784^T$ and 97.0% and 97.2% similarity to Deinococcus saxicola AA-$1444^T$, respectively. The sequence similarity with the type strains of other Deinococcus species was less than 96.9% for both strains. Strains $Ant21^T$ and Ant22 shared relatively high 16S rRNA gene sequence similarity (99.3%) and had a closely related DNA reassociation value of $84{\pm}0.5%$. Meanwhile, they showed a low level of DNA-DNA hybridization (<30%) with other closely related species of the genus Deinococcus. The two strains also showed typical chemotaxonomic features for the genus Deinococcus, in terms of the major polar lipid (phosphoglycolipid) and the major fatty acids ($C_{16:0}$, $C_{16:1}$ ${\omega}6c/{\omega}7c$, $iso-C_{17:0}$, and $iso-C_{15:0}$). They grew at temperatures between $4^{\circ}C$ and $30^{\circ}C$ and at pH values of 6.0-8.0. Based on the physiological characteristics, the 16S rRNA gene sequence analysis results, and the low DNA-DNA reassociation level with Deionococcus marmoris, strains $Ant21^T$ ($=KEMB\;9004-167^T$ $=JCM\;31436^T$) and Ant22 (KEMB 9004-168 =JCM 31437) represent novel species belonging to the genus Deinococcus, for which the name Deinococcus rubrus is proposed.

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Korean Journal of Microbiology
• /
• v.30 no.4
• /
• pp.269-277
• /
• 1992

Several insertion mutants of Escherichia coli in the ant gene, coding for $Na^{+}$ $H^{+}$ antiport activity, showed littel, if any, reduction in the antiport activity. $Na^{+}$ dependent transport activity also remained at wild type level. These facts led to the idea that E. coli has evolved at least two distinct systems for extrusion of $Na^{+}$ The antiport activities were studied under various conditions to reveal different properties of these systems. For convenience these activities are referred to as major and minor activities. The distinguishing properties of the two systems include : kinetics (Km, Vm) at pH 7.8, competition pattern between $Na^{+}$ and Li$^{+}$ , pH profiles, pattern of the change in kinetic parameters as a function of pH, and sensitivity to protease, chemicals and heat.

• Proceedings of the Korean Society of Life Science Conference
• /
• 2006.09a
• /
• pp.109.2-109.2
• /
• 2006

• Korean Journal of Microbiology
• /
• v.31 no.2
• /
• pp.136-140
• /
• 1993

The A. nidulans expression vector which contained trpC marker gene from A. nidulans was constructed to produce glucoamy]ase. The recombinant plasmid was introduced into auxotrophic mutant A. nidulans B17. Southern blot analysis of the genomic DNA from transformant showed that pKHG2 DNA had integrated into the A. nidulans chromosomes. Northern analysis of the total RNA from transform ant showed that mRNA of glucoamylase gene was synthesized in induction condition. Specific activity of glucoamylase was increased in transform ants. G]ucoamylase was shown to be active in non-denaturing acrylamide gel.

• Korean Journal of Clinical Laboratory Science
• /
• v.44 no.3
• /
• pp.155-165
• /
• 2012

The purpose of this study was to develop a multiplex PCR for the detection of aac(6')-Ib, aph(3')-Ia, and ant(2")-Ia; the genes that encode the most clinically relevant aminoglycoside modifying enzymes (AMEs) in Gram-negative bacteria. Clinical isolates of 80 E. coli and 23 K. pneumoniae from tertiary university hospital were tested by multiplex PCR. The most prevalent AME gene was aac(6')-Ib which was found in 22.3% of the isolates. Of the total 80 E. coli isolates, 1 isolate was found to contain both aph(3')-Ia and ant(2")-Ia simultaneouly. Of the total 23 K. pneumoniae isolates, 2 isolates were found to contain both aac(6')-Ib and aph(3')-Ia, and 1 isolate was found to contain both aac(6')-Ib and ant(2")-Ia simultaneously. Annual (2005~2009) analysis of isolates that contain the AME genes were of no correlation. The sensitivity and specificity of multiplex PCR in detecting AME genes was 94.4% (34 of 36 cases) and 100%, respectively. We suggest the multiplex PCR method we developed could be highly sensitive and specific in detecting the AME genes of E. coli and K. pneumoniae. This study could be the first published investigation in which the multiplex PCR method detects aac(6')-Ib, aph(3')-Ia, and ant(2")-Ia genes.

• Journal of Life Science
• /
• v.9 no.2
• /
• pp.169-175
• /
• 1999

Salmonella typhimurium can encounter a wide variety of environments during its life cycle. In nature, S. typhimurium can experience and survive dramatic acid stresses that occur in diverse ecological niches ranging from pond water to phagolysosomes. These survival mechanism is aquired by the Acid Tolerance Response(ATR) in Salmonella. The ATR of S. typhimurium is a complex inducible phenomenon in which exposures to slight or moderate low pH will produce a stress response capable of protecting the organism against more severe acid challenges. ATR in Salmonella has two different systems that are called RpoS dependent and independent. We found that ATR in anaerobic was showed RpoS independent because rpoS$\Omega$AP had ATR as S. typhimurium UK1. Using the P22 MudJ(Km, lacZ) operon fusion technique and a lethal selection procedure combining low pH(pH4.5) and sodium acetate(10mM, pH4.5), we isolated LF487 aatA::MudJ which showed acid sensitive in anaerobic condition. aatA locus was determined at 12 min on Salmonella Genetic Map. The survival rate of aatA mutant was showed significantly diminished at pH4.3 than virulent wild type Salmonella in anaerobic condition(5% $CO_2$, 5% H$_2$, 90% $N_2$). Therefore isolated gene was confirmed important gene for anaerobic ATR system.

• Journal of Veterinary Science
• /
• v.24 no.6
• /
• pp.82.1-82.12
• /
• 2023

Background: The current conventional serotyping based on antigen-antisera agglutination could not provide a better understanding of the potential pathogenicity of Salmonella enterica subsp. enterica serovar Brancaster. Surveillance data from Malaysian poultry farms indicated an increase in its presence over the years. Objective: This study aims to investigate the virulence determinants and antimicrobial resistance in S. Brancaster isolated from chickens in Malaysia. Methods: One hundred strains of archived S. Brancaster isolated from chicken cloacal swabs and raw chicken meat from 2017 to 2022 were studied. Two sets of multiplex polymerase chain reaction (PCR) were conducted to identify eight virulence genes associated with pathogenicity in Salmonella (invasion protein gene [invA], Salmonella invasion protein gene [sipB], Salmonella-induced filament gene [sifA], cytolethal-distending toxin B gene [cdtB], Salmonella iron transporter gene [sitC], Salmonella pathogenicity islands gene [spiA], Salmonella plasmid virulence gene [spvB], and inositol phosphate phosphatase gene [sopB]). Antimicrobial susceptibility assessment was conducted by disc diffusion method on nine selected antibiotics for the S. Brancaster isolates. S. Brancaster, with the phenotypic ACSSuT-resistance pattern (ampicillin, chloramphenicol, streptomycin, sulphonamides, and tetracycline), was subjected to PCR to detect the corresponding resistance gene(s). Results: Virulence genes detected in S. Brancaster in this study were invA, sitC, spiA, sipB, sopB, sifA, cdtB, and spvB. A total of 36 antibiogram patterns of S. Brancaster with a high level of multidrug resistance were observed, with ampicillin exhibiting the highest resistance. Over a third of the isolates displayed ACSSuT-resistance, and seven resistance genes (β-lactamase temoneira [bla_TEM], florfenicol/chloramphenicol resistance gene [floR], streptomycin resistance gene [strA], aminoglycoside nucleotidyltransferase gene [ant(3")-Ia], sulfonamides resistance gene [sul-1, sul-2], and tetracycline resistance gene [tetA]) were detected. Conclusion: Multidrug-resistant S. Brancaster from chickens harbored an array of virulence-associated genes similar to other clinically significant and invasive non-typhoidal Salmonella serovars, placing it as another significant foodborne zoonosis.

• Journal of Species Research
• /
• v.6 no.2
• /
• pp.91-100
• /
• 2017

Five bacterial strains, ES10-3-3-1, KKM10-2-2-1, Ant11, JM10-4-1-3, and KMS4-11 assigned to the genus Deinococcus were isolated from soil samples collected from Namyangju-si in Gyeonggi-do, Gangnam-gu and Dongdaemun-gu in Seoul, Korea. In addition, four bacterial strains, KKM10-2-7-2, JM10-2-5, JM10-2-6-2, and KKM10-2-3 assigned to the genus Hymenobacter were isolated from soil samples collected from Gangnam-gu and Dongdaemun-gu in Seoul, in South Korea. The five Deinococcus species were Gram-stain positive, pink-pigmented, and short-rod or coccus shaped. The four Hymenobacter species were Gram-stain negative, red-pigmented, and short-rod shaped. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strains ES10-3-3-1, KKM10-2-2-1, Ant11, JM10-4-1-3, and KMS4-11 were most closely related to Deinococcus citri $NCCP-154^T$ (with 99.8% similarity), Deinococcus grandis DSM $12784^T$ (99.0%), Deinococcus marmoris DSM $12784^T$ (98.8%), Deinococcus claudionis $PO-04-19-125^T$ (98.7%), and Deinococcus radioresistens $8A^T$ (99.8%), respectively. KKM10-2-7-2, JM10-2-5, JM10-2-6-2, and KKM10-2-3 were most closely related to Hymenobacter algoricola $VUG-A23a^T$ (99.1% similarity), Hymenobacter elongatus $VUG-A112^T$ (99.1% similarity), Hymenobacter gelipurpurascens $Txg1^T$ (99.1% similarity), and Hymenobacter psychrotolerans $Tibet-IIU11^T$ (99.3% similarity), respectively. These nine species have never been reported in Korea; thus, five Deinococcus species are reported in the family Deinococcaceae, order Deinococcales, class Deinococci, phylum Deinococcus-Thermus and four Hymenobacter species are reported in the family Cytophagaceae, order Cytophagales, class Cytophagia, phylum Bacteroidetes.

• Reproductive and Developmental Biology
• /
• v.35 no.3
• /
• pp.209-214
• /
• 2011

Although the function and utility of RNA transcripts derived from matured spermatozoa remains unclear, they might play important roles in the establishment of a paternal genome and subsequently embryo development. Herein, we investigated the expression of X-chromosome linked RNA transcripts in matured bovine spermatozoa. The total RNA was extracted from the matured spermatozoa, and then converted to cDNA. Autosomal genes (ACT-${\beta}$ and H-2A) and X-chromosome linked genes (ANT3, HPRT, MeCP2, RPS4X, XIAP, XIST and ZFX) were analyzed for the characterization of X-chromosome linked RNA transcripts and compared to female fibroblasts by RT-PCR. The transcripts of autosomal genes (ACT-${\beta}$ and H2A) and X-chromosome linked genes (ANT3, HPRT, MeCP2, RPS4X and ZFX) were not detected in spermatozoa. However, XIAP (X-linked inhibitor of apoptosis protein) and XIST (X-chromosome inactive-specific transcript, a kind of paternal imprinted gene) transcripts were detected in spermatozoa, and relative levels of XIAP and XIST transcripts were similar and 0.5-fold lower when compared to female fibroblasts, respectively. Based on the findings, it is summarized that the presence of RNA transcripts of XIAP and XIST in the isolated spermatozoa may imply their role in inhibition of apoptosis and induction of X-chromosome inactivation in embryo development.