• 한국식물병리학회:학술대회논문집
• /
• 한국식물병리학회 2003년도 정기총회 및 추계학술발표회
• /
• pp.65.2-65
• /
• 2003

To protect the plant against several soil-borne pathogens, we are currently constructing disease-resistant transgenic root stock for the growth of cucurbitaceae vegetable plants, watermelon and gourd. We made a watermelon cDNA library from Cladosporium cucumerinum-Infected leaves for substractive hybriazation and differential screening. We isolated the several pathogen inducible cDNA clones, such as caffeoyl-CoA-methyltransferase, LAA induced protein, receptor-like kinase homolog, hydroxyproline-rich glycoprotein, catalase, calmodulin binding protein, mitochondrial ATPase beta subunit, methyl tRNA synthetase and WRKY transcription factors. We previously obtained CaMADS in pepper and galactinol synthase ( CsGolS) in cucumber that were confirmed to be related with disease-resistance. CaMADS and CsGolS2 were transformed into the inbred line 'GO701-2' gourd, the inbred line '6-2-2' watermelon and the Kong-dye watermelon by Agrobacterium tumerfaciens LBA4404. Plant growth regulators (zeatin, BAP and IAA) were used for shoot regeneration and root induction for optimal condition. Putative transgenic plants were selected in medium containing 100mg/L kanamycin and integration of the CaMADS and CsGO/S2 into the genomic DNA were demonstrated by the PCR analysis. We isolated major soil-borne pathogens, such as Monosporascus cannonballus, Didymella bryoniae, Cladosporium cuvumerinum from the cultivation area of watermelon or root stock, and successfully established artificial inoculation method for each pathogen. This work was supported by a grant from BioGreen 21 program, Rural Development Administration, Republic of Korea.

• The Plant Pathology Journal
• /
• 제30권4호
• /
• pp.432-436
• /
• 2014

The soil-borne ascomycete fungus Cylindrocarpon destructans causes ginseng root rot disease and produces various secondary metabolites such as brefeldin A and radicicol. The slow growth of this fungus compared with other plant pathogenic and saprophytic fungi in soil disturbs isolation of this fungus from soil and infected ginseng. In this study, we developed a selective medium for C. destructans using radicicol produced by this fungus. Supplementing 50 mg/L of radicicol to medium inhibited the mycelia growth of other fungi including Botrytis cinerea, Rhizoctonia solani and Alternaria panax, but did not affect the growth of C. destructans. In addition, conidia germination of other fungal species except for C. destructans was inhibited in submerged culture supplemented with radicicol. This medium provides a very efficient tool for isolating C. destructans and also can be used as an enrichment medium for this fungus.

• The Plant Pathology Journal
• /
• 제16권3호
• /
• pp.156-161
• /
• 2000

A wilt disease occurred on greenhouse-grown eggplants at Yeojoo, Korea in 1997. The wilted eggplants had leaves with gradual yellowing, interveinal necrosis, and marginal crinkling. Vascular tissues of diseased stems were discolored, turned black, and microsclerotia developed at the base of stems. The disease progressed from lower parts of the plants upward. Fungal isolates from discolored vascular tissues were initially whitish to cream color on potato-dextrose agar (PDA) plate, which later turned black due to the formation of microsclerotia. Conidiophores were erect, hyaline, verticillately branched, and had 3 or 4 phialides arising at each node. Phialides were hyaline, arranged in whorls, and measured as 17.5-32.5 x 2-3$\mu\textrm{m}$. Conidia were hyaline, ellipsoidal to sub-cylindrical, mainly one-celled, and measured as 5-8.8 x 2-4$\mu\textrm{m}$. Conidia were borne in small clusters at the tips of phialides. Microsclerotia formed on PDA plates, and consisted of globular cells that formed irregular masses of various shapes. Chlamydospores were absent. Based on these cultural and morphological characteristics, the fungus was identified as Verticillium dahliae Klebahn. Pathogenicity tests by root cutting, root dipping or soil drenching resulted in similar symptoms observed in the naturally infected eggplants. This is the first report on occurrence of Verticillium wilt of eggplant in Korea.

• Mycobiology
• /
• 제51권4호
• /
• pp.195-209
• /
• 2023

The seed borne disease such as bakanae is difficult to control. Crop yield loss caused by bakanae depending on the regions and varieties grown, ranging from 3.0% to 95.4%. Bakanae is an important disease of rice worldwide and the pathogen was identified as Fusarium fujikuroi Nirenberg (teleomorph: Gibberella fujikuroi Sawada). Currently, four Fusaria (F. fujikuroi, F. proliferatum, F. verticillioides and F. andiyazi) belonging to F. fujikuroi species complex are generally known as the pathogens of bakanae. The infection occurs through both seed and soil-borne transmission. When infection occurs during the heading stage, rice seeds become contaminated. Molecular detection of pathogens of bakanae is important because identification based on morphological and biological characters could lead to incorrect species designation and time-consuming. Seed disinfection has been studied for a long time in Korea for the management of the bakanae disease of rice. As seed disinfectants have been studied to control bakanae, resistance studies to chemicals have been also conducted. Presently biological control and resistant varieties are not widely used. The detection of this pathogen is critical for seed certification and for preventing field infections. In South Korea, bakanae is designated as a regulated pathogen. To provide highly qualified rice seeds to farms, Korea Seed & Variety Service (KSVS) has been producing and distributing certified rice seeds for producing healthy rice in fields. Therefore, the objective of the study is to summarize the recent progress in molecular identification, fungicide resistance, and the management strategy of bakanae.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• 식물병연구
• /
• 제11권1호
• /
• pp.48-55
• /
• 2005

Cylindrocarpon destructans는 인삼 및 수목에 뿌리썩음병을 일으키는 토양 전염병 식물병원균이다. 신속 정확한 검출 가능성을 알아보기 위하여 종 특이적인 primer와 nested PCR 기법을 활용하여 인삼 유묘로부터 뿌리썩음 병균 C. destructans로 2차 PCR증폭을 실시한 결과 병원성이 확인된 C.destructans에서만 400bp의 종특이적 증폭산물을 얻을 수 있었다. 종 특이성 primer 와 nested PCR 기법을 이용한 인삼뿌리썩음병균 DNA에 대한 반응 민감도는 최저 약 1fg으로 나타나 단 몇 개의 포자만 존재해도 검출이 가능하였다. 또한, nested PCR 기법은 실제 이병토양에 심었을 경우에도 C.destructans 에 감염된 인삼 유묘로부터만 정확하게 병원균을 검출해 내었다. 종특이적 primer 와 nested PCR 기법을 이용한 본 연구 결과는 실제 재배농가에서 인삼 경작시 뿌리썩음병 진단에 매우 유용하게 활용될 수 있을 것으로 판단된다.

• 원예과학기술지
• /
• 제30권4호
• /
• pp.442-448
• /
• 2012

최근 상추와 같은 농산물에 의한 식중독사고가 발생하고 있으며 그 원인으로 병원성 미생물에 오염된 퇴비, 관개용수의 사용이라고 보고되고 있다. 따라서 본 연구는 육묘단계의 상토, 재배과정의 토양, 관개용수의 Escherichia coli와 Bacillus cereus 오염이 상추의 안전성에 미치는 영향을 구명하고자 수행하였다. 이를 위하여 상토는 두 균주로 7.5log CFU/g 수준으로 오염시킨 후 상추종자를 파종하고 28일간 생육시켰고, 오염되지 않은 토양과 6.0log CFU/g 수준으로 오염시킨 토양에 오염된 상토에서 21일간 자란 묘를 이식하고 49일간 인공기상동 ($25^{\circ}C$, 상대습도 70-80%)에서 생육시켰다. 또한 8.0log CFU/mL로 오염된 관개용수로 지표면관수법과 살수관수법으로 상추에 관수하고 40일간 병원성 미생물의 오염 및 생존을 조사하였다. 그 결과 육묘기의 상토와 상추 중 E. coli와 B. cereus는 시간이 경과함에 따라 점차 감소하였지만 육묘기 내내 생존 가능한 것으로 확인되었다. 토양에서는 42일간 E. coli와 B. cereus가 6.0log CFU/g 내외로 유의적인 감소 없이 유지되고 있었다. 오염된 토양에 이식된 상추는 21일째까지 E. coli와 B. cereus의 농도가 4.0log CFU/g 이상 유지되었고 이식 후 42일까지도 검출되었다. 또한 살수관수법으로 처리한 구에서 지표면관수법으로 처리한 구보다 상추의 오염수준이 5.0log CFU/g 정도 높았다. 따라서 본 연구의 결과는 병원성미생물에 오염된 상토, 토양, 관개용수는 농산물의 병원성미생물 오염에 직접적인 원인이 될 수 있음을 시사한다.

• 환경생물
• /
• 제40권4호
• /
• pp.398-404
• /
• 2022

본 연구는 플라스틱 가소제인 DEHP가 식물 병원균 중 하나인 P. carotovorum SCC1 균주에 미치는 영향을 조사하였다. DEHP가 균주 생장과 대사에 미치는 영향을 조사한 결과, 개체군 변화에 유의한 영향을 주지 않았으며, 세포막 투과성, ATPase 활성에 유의한 변화가 없었지만 TCA cycle 에서 DEHP 첨가에 따라 Succinyl-CoA synthase 활성이 유의적으로 감소하였다. 병원성 관련 유전자 발현량을 관찰한 결과 pectate lyase 유전자 발현량이 상대적으로 증가한 반면, pectinase 유전자는 상대적으로 발현량이 감소하였다. 따라서 DEHP는 P. carotovorum SCC1의 개체군 변화나 대사에는 유의미한 영향을 미치지 않지만 병원성 관련 유전자 발현에 영향을 미치므로 본 연구 결과는 향후 실제 식물 재배 조건에서 DEHP가 존재할 때 P. carotovorum의 특성에 관한 기초연구 자료로 활용할 수 있을 것이라 사료된다.

• The Plant Pathology Journal
• /
• 제19권3호
• /
• pp.184-187
• /
• 2003

Verticillium wilt was first observed in 2001 on potatoes (Solanum tuberosum) cv. Superior at Daegwallyong area, one of the major seed potato producing areas in Korea. The wilted potato plants showed typical symptoms including gradual yellowing and interveinal necrosis. There was discoloration in the vascular tissues of the infected stems which turned light brown. Fungal isolates from discolored vascular tissues were whitish to creamy with folding on potato dextrose agar medium, where they used to produce resting dark mycelia but no micro-sclerotia. Conidiophores were septate with side branches, swelled at the base, and arranged in a whorl. Conidia were 2.5-11.2$\times$2.0-4.5 $\mu\textrm{m}$ um in size and were borne in small clusters at the tips of phialides. Optimal temperature range for mycelial growth was $25-30^{\circ}C$. Based on these cultural and morphological characteristics, the fungus was identified as Verticillium albo-atrum Reink & Berth. Pathogenicity tests by root dipping method revealed that the fungus caused the same symptoms as observed in naturally infected potato plants. This is the first report of Verticillium wilt on potato caused by Verticillium albo-atrum in Korea.

• 한국미생물·생명공학회지
• /
• 제20권3호
• /
• pp.263-270
• /
• 1992

채소 등 작물의 부패균인 Erwinia carotovora subsp. carotovora의 생육을 억제하는 길항세균을 경작지 표토층으로부터 분리하고 배양조건에 따른 억제력변화를 조사하고, 길항관련 유전자의 소재를 확인하였다. 분리균들중 가장 우수한 억제력을 갖는 S4, S14, S65 균주를 최종 선발하고 Pseudomonas 근연종으로 동정하였다. 523 배지를 사용하여 배양조건에 따른 억제력 변화를 조사한 결과 배지초기 pH를 7-8로 조정하여 $30^{\circ}C$에서 3일간 배양하였을 때 가장 높은 억제력을 보였고, 배지성분중 탄소원으로 mannitol과 sorbitol, 무기염으로 CaCl2를 첨가했을 때 효과적이었으나 질소원에 대한 감수성은 낮았다.