• Journal of Microbiology and Biotechnology
• /
• 제25권8호
• /
• pp.1234-1240
• /
• 2015

Heat shock RNA 1 (HSR1) is described as a "eukaryotic heat-sensing noncoding RNA" that regulates heat shock response in human and other eukaryotic cells. Highly conserved HSR1 sequences have been identified from humans, hamsters, Drosophila, Caenorhabditis elegans, and Arabidopsis. In a previous study, however, it was suggested that HSR1 had originated from a bacterial genome. HSR1 showed no detectible nucleotide sequence similarity to any eukaryotic sequences but harbored a protein coding region that showed amino-acid sequence similarity to bacterial voltage-gated chloride channel proteins. The bacterial origin of HSR1 was not convincible because the nucleotide sequence similarity was marginal. In this study, we have found that a genomic contig sequence of Comamonas testosteroni strain JL14 contained a sequence virtually identical to that of HSR1, decisively confirming the bacterial origin of HSR1. Thus, HSR1 is an exogenous RNA, which can ectopically trigger heat shock response in eukaryotes. Therefore, it is no longer appropriate to cite HSR1 as a "eukaryotic functional noncoding RNA."

• 미생물학회지
• /
• 제29권5호
• /
• pp.284-289
• /
• 1991

the nucleotide sequence of the 3' terminal 568 bases of the 18S rRNA gene from Mucor racemosus was determined. The 3' end of the structural gene was identified by comparison with the published sequence for the Saccharomyces cerevisiae gene. The M. racemosus gene was found to share 83.8% homology with that of S. cerevisiae and 71-81% homology with those of human, mouse, maize, Xenopus laevis and Tetrahymena thermophila. The known methylation sites in X. laevis and human were also highly conserved in M. racemosus and located within most conserved regions of 18S RNA gene throughout evolution.

• Journal of Microbiology
• /
• 제33권2호
• /
• pp.136-141
• /
• 1995

From a cluster of structural rRNA genes which has previsouly been cloned (Hwang and Kim, in submission; J. Microbiol. Biotechnol.), a 1.0-kb Eco RI fragment of DNA which shows significant homology to the 25S and rRNA s of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was bidirectionally determined using delection series of the DNA fragment. Comparing the resultant 1016-base sequence with sequences in the database, both the 3'end of 25S-rRNA gene and 5S rRNA gene were searched. The 5S rRNA gene is 118-bp in length and is located 158-bp downstream of 3'end of the 25S rRNA gene. IGSI and IGS2 (partial) sequences are also contained in the fragment. Multiple alignment of the 5S rRNA sequences was carried out with 5S rRNA sequences from some members of the subdivision Basidiomycotina obtained from the database. Polygenetic analysis with distance matrix established by Kimura's 2-parameter method and phylogenetic tree by UPGMA method proposed that T. matsutake is closely related to efibulobasidium allbescens. Secondary structure of 5S rRNA was also hypothesized to show similar topology with its generally accepted eukaryotic counterpart.

• Journal of Plant Biology
• /
• 제38권2호
• /
• pp.129-136
• /
• 1995

Complementary DNA of the genomic RNA of odontoglossum ringspot virus Cymbidium strain (ORSV-Cy) was synthesized from polyadenylated viral RNA and cloned. Selected clones containing the viral RNA-dependent RNA polymerase gene of the virus has been sequenced by automated sequencing system. The complete nucleotide sequence of an open reading frame is 1377 base pairs in length, and encodes a protein of 458 amino acids about 52, 334 D. The 52 kD protein of ORSV shares four sequence motifs characteristic of viral RNA-dependent RNA polymerase. Comparison of the ORSV 52 kD protein sequence with that of other five viruses in tobamovirus group showed 76.0 to 60.7% homologies at the amino acid level and the conservation of the four motifs betwen the viruses.

• The Plant Pathology Journal
• /
• 제18권4호
• /
• pp.187-191
• /
• 2002

This paper describes the cloning and sequence analysis of the 5'-terminal region and full-length cDNA production of genomic RNA of Lily symptomless virus (LSV), a Species Of the genus Carlavirus. A sing1e DNA band about 600 bp harboring the 5'-end of genomic RNA of the virus was successfully amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE), and was cloned for nucleotide sequence determination. Sequence analysis of selected RACE cDNA clones revealed that the LSV 5'non-translated region consists of 67 nucleotides long of AT rich stretch followed GC rich from the 5'-end. To produce full-length cDNA products for the viral genomic RNA, a set of LSV-specific primers could be designed based on the obtained sequence in this study and the known sequences of 3'-terminal region for the virus. Full-length cDNA copies of LSV, an 8.4 kb long, were directly amplified by the long-template RT-PCR technique from the purified viral genomic RNA samples. This full-length cDNA copies were analyzed by restriction mapping. The molecules produced in this study can be useful for the production of in vitro infectious cDNA clone, as well as, for the completion of genomic RNA sequence and genome structure for the virus.

• 한국양식학회지
• /
• 제10권4호
• /
• pp.403-407
• /
• 1997

Intraspecific sequence variation was detected by polymerase chain reaction (PCR) and direct sequencing of a 350-nucleotide region of the mitochondrial 12S rRNA gene of two natural populations (Han River and Nakdong River) and one hatchery stock (Jinhae Inland Fisheries Institute) of local strain common carp, one Israeli strain of common carp stock from Pukyong National University (PKU), and one hybrid between Israeli strain of common carp female and local strain common carp male from PKU stock. There is little variation in 350 bases of the mitochondrial 12S rRNA gene sequences among 2 natural and 1 hatchery local strain common carp populatins, representing abut 7 to 20 nucleotide differences (less than 6%). The sequence of specimens from Han River was more similar to that from Nakdong River (identity=98.0%) than to that from Jinhae Inland Fisheries Institute (identity=96.3%). Sequence variation between Israeli strain and wild local strain common carp was higher than the variation within natural stocks. The level of variation was ranged from 15.7 to 17.7%. The hybrid showed very similar nucleotide4 sequence of 12S rRNA gene to the sequence of Israeli strain with the identity of 98.9%.

• Journal of Plant Biology
• /
• 제39권4호
• /
• pp.265-271
• /
• 1996

Full-length cDNA for RNA2 of cucumber mosaic virus strian Kor (Kor-CMV) was cloned downstream of synthetic T7 promoter by reverse transcriptase-polymerase chain reaction (RT-PCR). The clone could generate a full-length transcript corresponding to RNA1 in size when synthesized by T7 RNA polymerase. The complete nucleotide sequence has shown that the RNA2 is composed of 3,049 nucleotides and contains one functional open reading frame (ORF) of 2,574 nucleotides encoding 2a protein. The deduced translation product of the 2,574 nucleotides contains GDD motif which is a characteristic of RNA-dependent RNA polymerase (RdRp). The amino acid sequence analysis of the 2a protein has shown that the homology is found in decreasing order with O-CMV (98.8%), Y-CMV (98.7%), Fny-CMV (98.3%), KCMV (94.9%), Ix-CMV (91.9%), and Q-CMV (74.9%). Kor-CMV is suggested to belong to subgroup Ⅰ in the aspect of nucleotide sequence homology of RNA2.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Microbiology and Biotechnology
• /
• 제29권11호
• /
• pp.1790-1798
• /
• 2019

Flock House virus (FHV), an insect RNA virus, has a bipartite genome. FHV RNA1 can be packaged in turnip yellow mosaic virus (TYMV) as long as the FHV RNA has a TYMV sequence at the 3'-end. The encapsidated FHV RNA1 has four additional nucleotides at the 5'-end. We investigated whether the recombinant FHV RNA1 could replicate in mammalian cells. To address this issue, we prepared in vitro transcribed FHV RNAs that mimicked the recombinant FHV RNA1, and introduced them into baby hamster kidney (BHK) cells. The result showed that the recombinant FHV RNA1 was capable of replication. An eGFP gene inserted into the frame with B2 gene of the FHV RNA1 was also successfully expressed. We also observed that eGFP expression at the protein level was strong at 28℃ but weak at 30℃. Sequence analysis showed that the 3'-ends of the RNA1 and RNA3 replication products were identical to those of the authentic FHV RNAs. This indicates that FHV replicase correctly recognized an internally-located replication signal. In contrast, the 5'-ends of recombinant FHV RNA1 frequently had deletions, indicating random initiation of (+)-strand synthesis.

• 미생물학회지
• /
• 제30권5호
• /
• pp.397-402
• /
• 1992

서울지역의 소아설사환자가 가검물로부터 분리한 로타바이러스의 VP7을 코딩하는 RNA분절 cDNA를 합성한 후 로타바이러스 혈청형1인 WA1과 RE9의 아홉 번째 RNA분절과 비교하였더니 90%이상의 유사성을 보였다. 염기서열로부터 유추된 아미노산 서열중 혈청간에 변이가 많은 VR5와 VR8 지역을 비교한 결과 역시 혈청형 1인 RE9과 WA1 바이러스주와 매우 높은 유사성을 지님을 알 수 있었다.