• 제목/요약/키워드: Promoter

검색결과 2,892건 처리시간 0.026초

Sacharomyces cerevisiae에서 GAL또는 GAP 프로모터 조절에 의한 재조합 Inulinase의 발현 및 분비 (Expression and Secretion of Recombinant Inulinase under the Control of GAL or GAP Promoter in Sacharomyces cerevisiae)

  • 남수완;임현정정봉현장용근
    • KSBB Journal
    • /
    • 제11권4호
    • /
    • pp.445-452
    • /
    • 1996
  • 본 연구에서는 GALl, GALl, GALlO 및 GAP promoter 하류에 reporter 유전자인 K. marxianus의 inulinase 유전자(lNUl)를 연결하여 각각의 재조합 plasmid들을 구축하고, 이들로 형질전환된 S. cerevrswe를 회분배양(YPOG 배지 )하여 외래 유전자 발현에 미치는 promoter의 영향을 비교.검토하 였다. 재조합 효모의 최종 균체농도는 36-39 00600 값을 보여 promoter에 따른 큰 차이를 보이지 않았으나, 포도당 소모기간 동안 비증식속도는 평균 $0.24 h^{-1}$로 유지되다가 galactose 소모기간 동안에 GAL promoter 함유 효모배양의 경우 $0.04-0.06 h^{-1}$, pYIGP 함유 재조합 효모배양은 $0.10 h^{-1}$로 감소하였다. 포도당 고갈 후 inulinase 발현은 시작되었고 균체외 inulinase의 발현 수준은 배양 72시간에 4.3 (GALl promoter), 4.0 (GAL7 promoter), 3.8 (GAL10 promoter) 및 1.6 (GAP promoter) unit/mL에 도달하였다. 평판배지상에서의 활성염색과 회분배양의 결과(최종발현양 및 초기 inulinase 말현속도), inulinase 발현에 미치는 promoter 세기 는 GALl > GALlO > GAL7 > GAP 순임을 알 수 있었다. GAL promoter가 배양말기까지 78 % 이상의 높은 plasmid 안정성을 보인 반면에, GAP promoter의 경우 55%의 낮은 plasmid 안정성을 보였다. 또한, 재조합 inulinase는 promoter 종류에 상관없이 98% 이상 배양액으로 분비되였다.

  • PDF

알칼리 내성 Bacillus sp. YA-14에서 유래된 생육단계 조절 promoter의 발현 (Expression of Developmentally Regulated Promoter of Alkali-tolerant Bacillus sp. YA-I4)

  • 박영서;구본탁;박희경;유주현;김진만
    • 한국미생물·생명공학회지
    • /
    • 제18권4호
    • /
    • pp.429-432
    • /
    • 1990
  • 알카리 내성 Bacillus sp. YA-14의 chromosomal DNA로 부터 유래된 promoter를 subcloning하여 그 생화학적 특성과 포자형성과의 관계를 조사하였다. 알카리내성 Bacillus sp.와 B.subtilis에서 promoter의 활성은 포자가 형성되기 시작하는 단계에서 증가하기 시작했다. 또한 배지내 glucose가 1.0(w/v) 첨가시 promoter 활성이 억제되었다. 5가지의 spoO 유전자 중에서 3가지 유전자 (spoOB, spoOH, spoOJ) 산물이 promoter 활성에 필요하다.

  • PDF

B형 간염 바이러스의 ntC1731T 및 G1806A의 core 프로모터 돌연변이에 의한 HBV 유전자 발현 증가 분석 (Core Promoter Mutation of ntC1731T and G1806A of Hepatitis B Virus Increases HBV Gene Expression)

  • 조자영;이이조;성미소;정재훈
    • 생명과학회지
    • /
    • 제32권2호
    • /
    • pp.94-100
    • /
    • 2022
  • B형간염바이러스(HBV)의 만성 감염은 간경화와 간세포암 발생 빈도를 현저히 높인다. HBV 감염의 임상적 결과는 숙주 유전적 요인과 바이러스의 유전자 변이, 그리고 환경적 요인 등에 결정된다. HBV 복제를 위한 HBV의 pre-genomic RNA 전사는 바이러스의 core promoter 활성화에 의해 조절된다. Core promoter 돌연변이는 급성간 질환과 간세포암 발생에 연관되어 있다. 본 연구팀은 미얀마의 HBV 감염 환자들로부터 바이러스 유전자를 획득하여 core promoter 부위의 유전자 변이들을 파악하였다. Core promoter의 상대적 유전자 활성 차이를 분석하기 위해서 core promoter를 luciferase reporter에 재조합한 시스템을 제작하였다. 분석한 core promoter의 유전자 변이들 중에서 C1731T와 G1806A 돌연변이가 HBV core promoter의 전사 활성화를 증가에 관여하였다. 돌연변이 부위를 중심으로 전사 인자들의 가능한 결합 부위 변화를 컴퓨터 프로그램 분석을 통해 조사한 결과, C/EBPβ와 XBP1 반응 부위가 새롭게 생성되었음을 도출하였다. C/EBPβ의 세포 내 발현은 C1713T 돌연변이를 가진 core promoter의 전사 활성을 증가시켰으며, XBP1 발현은 G1806A 돌연변이를 함유한 M95 promoter를 활성을 증가시켰다. HBV 감염의 치료는 약제 내성과 백신 회피 돌연변이 발생으로 문제점을 가지고 있는 상황에서, 이 연구 결과는 HBV core promoter 돌연변이의 분자생물학적 그리고 임상학적 중요성을 제공한다.

고등 식물에서 Nopaline Synthase Promoter의 합성 조절 요소 (Synthetic Regulatory Elements of the Nopaline Synthase Promoter in Higher Plants)

  • Kim, Young-Hee
    • 식물조직배양학회지
    • /
    • 제22권4호
    • /
    • pp.201-205
    • /
    • 1995
  • Nopaline synthase promoter의 upstream element region을 본딴 nos-RP 요소라고 불리워진 합성 oligomer는 nos wild type promotor의 5' end에서부터 - 101까지를 절단한 promoter의 upstream에 삽입하였다. Nos promoter의 활성은 nos promoter와 연결되어 있는 reporter gene인 Chlorarnphenicol과 $\beta$-glucuronidase유전 인자들이 발현되는 현상을 연구함으로써 측정하였다. 형질 전환된 유전인자를 가지고 있는 담배 식물에 대한 분석은 nos minimal promoter의 활성이 합성 nos-RP 요소가 삽입됨으로써 회복될 수 있음을 보여 주었다. 또한 Nos minimal promoter의 upstream에 nos-RP 요소의 삽입은 여러 가지 환경적인 요소들인 auxin, dithiothreitol, salicylic acid 그리고 methyl jasmonate에 의해서 활성이 증가됨을 보여 주었다.

  • PDF

해양의 Pseudomonas sp. 로부터 분리한 alginate lyase 유전자의 promoter에 의한 대장균 내에서의 \beta-agarase 유전자의 발현과 catabolite repression의 변화 (Expression of \beta-agarase Gene and Carabolite Repression in Escherichia coli by the Promoter of Alginate Lyase Gene Isolated from Marine Pseudomonas sp.)

  • 공인수;박제현;한정현;최윤혁;이종희;진철호;이정기
    • 한국미생물·생명공학회지
    • /
    • 제29권2호
    • /
    • pp.72-77
    • /
    • 2001
  • Strong promoter로 밝혀진 alginate lyase 유전자의 promoter 부위에 대한 특성을 검토하기 위해 alginate lyase 유전자의 46개 N-terminal amino acid가 포함된 promoter 부분과, 같은 균으로부터 분리한 $\beta$-agarase의 유전자를 연결시켜 agarase의 activity를 평판배지상에서 보다 쉽게 확인하는 방법으로 promoter의 활성을 측정한 결과 alginate lyase 유전자 promoter에 의해서 $\beta$-agarase 유전자의 대량발현이 유도되고 있었으며 glucose의 존재하에서 $\beta$-agarase 유전자 발현이 일어나지 않는 catabolite repression 양상을 나타내고 있다. PCR로써 alginate lyase의 46개 N-terminal amino acid 부분이 순차적으로 제거된 plasmid를 제조하여 대량발현을 조사한 결과 46개의 아미노산이 제거된 후에도 $\beta$-agarase의 활성에는 변화가 없어 46개의 N-말단이 정상적인 상태에서 발현에는 영향을 미치고 있지 않음을 확인할 수 있었다. 또한 alginate lyase 유전자의 promoter region에 존재하는 가능한 2개의 promoter consensus sequence PI, PII를 subcloning한 결과 promoter PII만이 존재할 때도 대량발현이 유도되고 있음을 확인할 수 있었으며 동시에 glucose가 존재할 때 catabolite repression이 역시 나타나고 있어 이 부분이 발현 및 glucose에 의한 regulation에 매우 중요하게 작용하는 부분이라는 것을 확인할 수 있었다.

  • PDF

Characterization of an Oxygen-Dependent Inducible Promoter Systems, the nar Promoter of Escherichia coli, and Gram negative host strains

  • 이길호;조무환;이종원
    • 한국생물공학회:학술대회논문집
    • /
    • 한국생물공학회 2001년도 추계학술발표대회
    • /
    • pp.762-766
    • /
    • 2001
  • The nar promoter of Escherichia coli was known to induce maximally under anaerobic or microaerobic conditions in the presence of nitrate. In this study, the nar promoter was tested to see whether the expression level of a reporter gene which fused lacZ gene at nar promoter's downstream, in the some gram negative host strains(Agrobacterium, Pseudomonas and Rhizobium). A nar promoter system(Combination of nar promoter and gram negative strain) was grown under aerobic conditions to absorbance at 600 nm of nearly 2.0 and then, the nar promoter was induced by lowering DO to 1-2% with alternating microaerobic and aerobic condition in the fermentor cultures, using different gram negative hosts. For a wild type nar promoter (pNW61), it was possible to maintain production of ${\beta}-galactosidase$ activity per cell(specific ${\beta}-galactosidase$ activity) at 14,000, 9600, 45 Miller units in the presence of 1% nitrate. and for a nitrate - independent nar promoter (pNW618) at 12,000, 10,400 and 58 Miller units in the absence of nitrate ion, respectively.

  • PDF

Analysis of Heat Shock Promoters in Hansenula polymorpha: The TPS1 Promoter, a Novel Element for Heterologous Gene Expression

  • Amuel, Carsten;Gellissen, Gerd;Cor;Suckow, Manfred
    • Biotechnology and Bioprocess Engineering:BBE
    • /
    • 제5권4호
    • /
    • pp.247-252
    • /
    • 2000
  • The strength and regulatory characteristics of the heat-inducible HSA1, HSA2 and TPS1 promoters were compared with those of the well-established, carbon source-regulated FMD promoter in a Hansenula polymorpha-based host system in vivo. In addition, the Saccharomyces cerevisiae-derived ADH1 promoter was analysed. While ADH1 promoter showed to be of poor activity in the foreign host, the strength of the heat shock TPS1 promoter was found to exceed that of the FMD promoter, which at present is considered to be the strongest promoter for driving heterologous gene expression in H. polymorpha.

  • PDF

재조합 효모의 유가배양에서 Exoinulinase생산을 위한 Promoter의 선별 (Selection of Constitutive Promoter for Exoinulinase Production in Fed-Batch Culture of Recombinant Yeast)

  • 김이경;고지현;김연희;김성구;남수완
    • 한국미생물·생명공학회지
    • /
    • 제29권4호
    • /
    • pp.206-211
    • /
    • 2001
  • Klyyveromyces marxianus exoinulinase를 Saccharomyces cerevisiae에서 구성적으로 과발현 생산하기 위해, 구성적 promoter인 GAPDH, ADH1, PGK 및 ENOI promoters 하류에 exoinulinase 유전자 (INUI)의 ORF를 in frame으로 연결한 각각의 plasmi에 YIGP, pADHI,-INU, pPGK-INU 및 pENO-INU 를 구축하였다. 이들 각 plasmid를함유한 형질전환주 4종을 포도당 농도 5% 배지에서 회분배양한 결과 균체증식은 promoter에 따라 큰 차이를 보이지 않았지만 exoinulinase 발현수준과 plasmid 안정성은 사용한 promoter 에 크게 좌우되었다. 즉 exoinulinase 발현수준은 GAPDH PGK ADH1 ENO1 promoter 각각 1.70, 1.67 1.29, 0.80 unit/ml 였으며 plasmid 안정성은 GAPDH promoter 계의 55%를 제외하고 모두 80%이상으로 높게 나타났다. 이상의 plasmid 안정성과 exoinulinae 발현수준을 고려하여 ADH1 및 PGK 발현계를 선정하여 유가배양하였다 Yeast extract와 포도당을 간헐적으로 공급한 유가배양 결과, 두 발현계에서 약 30 g-DCW/1의 균체농도를 얻었지만, ADHI promoter 계에서는 3.70 unit/ml 의 최대 exoinulinase 활성과 96%의 plasmid 안정성을 보여TRh 반면에 PGK promoter 계는 각각 2.70 unit/ml/와 80%를 나타내었다. 따라서 plasmid 안정성과 긴 배양시간을 고려할 때 비선택적 영양배지를 사용하는 고농도세포 유가배양에서 ADH1 promoter가 exoinulinase 의 구성적 과발현, 생산에 더 적합할 것으로 사료된다.

  • PDF

효모(酵母) 유전자(遺傳子) 발현용(發現用) Promoter 개발(開發)에 관(關)한 연구(硏究) (Studies on the Development of Yeast Promoter for the Gene Expression)

  • 정호권;박준희;심상국;정동효
    • Applied Biological Chemistry
    • /
    • 제38권1호
    • /
    • pp.7-12
    • /
    • 1995
  • 본 연구는 lacZ' 유전자의 promoter 개발을 위하여 착수하였다. lacZ' 유전자의 heterologous promoter I과 II를 효모 염색체의 Bam HI DNA 단편에서 분리하였다. Promoter I의 크기는 2.5 Kb 정도이고 ${\beta}-galactosidase$ 활성은 124.6 U/mg protein이었으며 promoter II의 크기와 효소활성은 4.0 Kb와 168.8 U/mg이었다. 형질 전환체에서의 YEp plasmid 안정성은 52.7%에서 67.4% 정도였다. YEp plasmid로부터 YIp plasmid를 재조합하였으며 이 YIp plasmid는 대장균에서나 효모에서도 발현되었다. 효모로부터 분리한 promoter I과 II는 재조합된 YEp와 YIp plasmid의 promoter로서 이용 가능하였다.

  • PDF

Agrobacterium tumefaciens pTiA6 플라스미드의 virE 프로모터내 조절부위의 구조적 특성 (Structural Characterization of the Regulatory Site in virE Promoter of Agrobacterium tumefaciens pTiA6 Plasmid)

  • 음진성
    • Journal of Plant Biology
    • /
    • 제35권2호
    • /
    • pp.155-163
    • /
    • 1992
  • 식물세포에 tumor를 유발하는 Agrobacterium tumefaciens pTiA6 plasmid에서 virE 유전자의 발현조절기작을 분자적수준에서 규명하기 위하여 virE promoter의 5'-말단을 제거하여 얻은 truncated virE 재조합플라스미드를 이용하여 virE promoter의 조절부위에 대하여 연구하였다. virE promoter의 기능이 존재하는 truncated virE 재조합플라스미드인 pJS201은 전기영동에 의하여 virE promoter의 5'-말단으로부터 약 130개의 염기가 제거된 것으로 측정되었다. 한편 virE promoter의 기능을 상실한 pJS301에서 dideoxy chain termination방법으로 truncated virE promoter 염기서열을 결정한 결과 263개의 염기가 제거된 것으로 확인되었다. 따라서 virE promoter의 조절부위는 virE promoter의 5'-말단으로부터 약 130번째의 염기에서 263번째의 염기사이에 존재하는 것으로 사료되며, 이 사이에 23개의 염기로 이루어진 역반복서열(AACTTTGCGCTATAGGCAAAGTT)이 존재하고 있는데, 이 부위가 virE operon의 발현에 있어서 RNA polymerase의 최초 인식부위(recognition site)일 것으로 사료된다.

  • PDF