• Biotechnology and Bioprocess Engineering:BBE
• /
• 제3권1호
• /
• pp.1-5
• /
• 1998

One cervical cancer cell line, C9, carrying human papillomavirus type 18 (HPV18) genes that is one of the major etiologic concoviruses for cervical cancer was characterized. This cell line was further characterized for its capacity related to the epithelial cell proliferation, stratification and differentiation in reconstituted artificial epithelial tissue. The in vitro construction of three dimensional artificial cervical opithelial tissue has been engineered using C9 epithelial cancer cells, human foreskin fibroblasts and a matrix made of type I collagen by organotypic culture of epithelial cells. The morphology of paraffin embedded artificial tissue was examined by histochemical staining. The artificial epithelial tissues were well developed having multilayer. However, the tissue morphology was similar to the cervical tissus having displasia induced by HPV infection. The characteristics of the artificial tissues were examined by determinining the expression of specific marker proteins. In the C9 derived artificial tissues, the expression of EGF receptor, as epithelial proliferation marker proteins for stratum basale was observed up to the stratum spinosum. Another epithelial proliferation marker for stratum spinosum, cytokerations 5/6/18, were observed well over the stratum spinosum. For the differentiation markers, the expression of involucrin and filaggrin were observed while the terminal differentiation marker, cytokeratins 10/13 was not detected at all. Therefore the reconstituted artificial epithelial tissues expressed the same types of differentiation marker proteins that are expressed in normal human cervical epithelial tissues but lacked the final differentiation capacity representing characteristics of C9 cell line as a cancer tissue devived cell line. Expression of HPV18 E6 oncoprotein was also observed in this artifical cervical opithelial tissue though the intensity of the staining was weak. Thus this artificial epithelial tissue could be used as a useful model system to examine the relationship between HPV-induced cervical oncogenesis and epithelial cell differentiation.

• Mycobiology
• /
• 제47권2호
• /
• pp.200-206
• /
• 2019

Allelic differences in A and B mating-type loci are a prerequisite for the progression of mating in the genus Pleurotus eryngii; thus, the crossing is hampered by this biological barrier in inbreeding. Molecular markers linked to mating types of P. eryngii KNR2312 were investigated with randomly amplified polymorphic DNA to enhance crossing efficiency. An A4-linked sequence was identified and used to find the adjacent genomic region with the entire motif of the A locus from a contig sequenced by PacBio. The sequence-characterized amplified region marker $7-2_{299}$ distinguished A4 mating-type monokaryons from KNR2312 and other strains. A BLAST search of flanked sequences revealed that the A4 locus had a general feature consisting of the putative HD1 and HD2 genes. Both putative HD transcription factors contain a homeodomain sequence and a nuclear localization sequence; however, valid dimerization motifs were found only in the HD1 protein. The ACAAT motif, which was reported to have relevance to sex determination, was found in the intergenic region. The SCAR marker could be applicable in the classification of mating types in the P. eryngii breeding program, and the A4 locus could be the basis for a multi-allele detection marker.

• Asian-Australasian Journal of Animal Sciences
• /
• 제14권11호
• /
• pp.1505-1510
• /
• 2001

A method for mapping quantitative trait loci (QTL) was introduced incorporating the information of mixed progeny from complex pedigrees. The method consisted of two steps based on single marker analysis. The first step was to examine the marker-trait association with a mixed model considering common environmental effect and reversed QTL-marker linkage phase. The second step was to estimate QTL effects by a weighted least square analysis. A simulation study indicated that the method incorporating mixed progeny from multiple generations improved the accuracy of QTL detection. The influence of within-genotype variance and recombination rate on QTL analysis was further examined. Detecting a QTL with a large within-genotype variance was more difficult than with a small within-genotype variance. Most of the significant marker-QTL association was detectable when the recombination rate was less than 15%.

• KSBB Journal
• /
• 제17권1호
• /
• pp.106-109
• /
• 2002

Gel electrophoresis of DNA is a well known technique in molecular biology. This technique is simple, rapid to perform, and capable of adequately separating fragments of DNA. A number of mixtures of DNA fragments ("DNA size markers") are frequently employed in a purpose of extrapolating the sizes or the amount of DNA molecules during gel electrophoresis. DNA size markers are constructed by digesting plasmid DNA, bacteriophage DNA, or recombinant DNA molecules with one or more restriction enzymes. However, liquid suspension containing DNA size marker needs to be kept at a low temperature during storage and shipping. In an attempt to maintain the DNA samples at room temperature for extended period of time, lyophilization of DNA with addition of nuclease inhibitor was studied. Gel loading buffer was also added to the lyophilized DNA to provide additional convenience such that DNA size marker was the "ready-to-use" followed by simply reconstituting with distilled water.

• Journal of Chest Surgery
• /
• 제30권7호
• /
• pp.701-707
• /
• 1997

그동안 폐암의 발생에 관여하는 여러가지 유전자의 이상이 보고되어 왔으나 모든 종류의 폐암에서 보이는 비억제적 성장(unconkolle6 growth)을 대변할 수 있는 유전자적 종양 표시자(molecular tumor marker)는 보고된 바 없었다. 최근 유전자(chromosome)의 말단부에 위치한 특이한 구조인 telomere가 세포의 노화나 증식정도 (proliferative activity)에 따라 그 구조, 특히 TrAGGG 반복 구조가 변한다는 것이 알려진 바 있다. 따라서 telomere의 반복 구조를 만드는 효소인 telomerase의 활성도는 대상 세포의 증식 상황이나 증식 가능성을 나타내는 표시 자로서의 기능이 있다고 추정된다. 따라서 이는 종양의 진단은 물론 대상 환자의 향후 예후를 판 단하는 데도 좋은 지표로 이용될 수 있다. 12개의 다양한 비소세포폐암 세포주와 수술로 적출된 41명의 비세포계암 환자의 종양 조직에 대해 nROolymerase chain reaction)을 기초로 한 TRAP assay를 이용하여 telomeiase활성도를 측정하였다. 대조군으로는 동시에 적출된, 종양으로부터 가장 먼 위치의 정상 폐조직을 이용하였다. 12개 전 종양 세포주는 물론 대부분의 종양 조직(94%)에서, 성별, 연령, 세포 병리학적 subtype, 암기(stage) 등과 관련이 언이, telomerase의 활성도가 측정되었으며 정상이라고 간주된 조직에서는 5명으로 부터 채취한 조직에서만 미약하게 telomerase활성도가 관찰되었다. 예후에 연관지어 telomerase활성도의 의미는 telmerase활성도가 보이지 않는 종글이 극히 적었고 또한 추적 관찰 기간이 짧아 판정할 수 없었다. Telomere의 길이의 변화는의미를 판정키 어려웠다. 이상의 결과는 비소세포폐암에 있어 telomerase활성도의 변화가 암발생에 아주 중요한 과정일 수 있다는 추정을 가능하게 하며 telomerase활성도의 측정이 종양의 진 단에 유용하게 이용될 수 있음을 확인시켜 주는 것이라 사료된다.

• 원예과학기술지
• /
• 제34권1호
• /
• pp.134-141
• /
• 2016

멜론에서 개발된 단성화 연관 마커인 T1ex를 참외계통 선발에 적용하였다. T1ex 마커가 멜론에서는 단성화에 대해 두 가지 크기의 변이를 보였으나 참외에서는 단일 크기 변이를 보였고 하나의 계통을 제외한 나머지 105 계통에서 단성화와 양성화에 대한 표현형과 유전자형이 99% 일치함을 보였다. 또한 T1ex 단성화 연관마커의 MAS 적용가능성을 확인하기 위해 참외 품종 육성에 이용되고 있는 240개 개체 중 분자마커 선택법으로 선발된 98개체를 비교해 본 결과 표현형과 유전자형이 100% 일치하였고, 이형 유전자형을 조기에 효과적으로 제거 할 수 있음을 확인하였다. 따라서 멜론에서는 적용이 어렵다고 판단된 단성화 연관 마커 T1ex가 참외에서는 계통 육성과정에서 적용 가치가 매우 높다고 평가된다.

• BMB Reports
• /
• 제36권2호
• /
• pp.173-178
• /
• 2003

Malignant melanoma is one of the most rapidly increasing cancer types, and patients with metastatic disease have a very poor prognosis. Detection of metastatic melanoma cells in circulation may aid the clinician in assessing tumor progression, metastatic potential, and response to therapy. Tyrosinase is a key enzyme in melanine biosynthesis. The gene is actively expressed in melanocytes and melanoma cells. Melan A is a differentiation antigen that is expressed in melanocytes. The presence of these molecules in blood is considered a marker for circulating melanoma cells. In this study, we analyzed the usefulness of this marker combination I evaluating the response to therapy in the blood of 30 patients with malignant melanoma. Circulating cells were detected by a reverse-transcriptase-polymerase-chain reaction. The tyrosinase expression was observed in 9 (30%) patients and Melan A in 19 (63.3%) patients before therapy. Following treatment, the tyrosinase mRNA was detected in only one patient, while Melan A transcripts were still present in 14 patients. We suggest that this molecular assay can identify circulating melanoma cells that express melanoma-associated antigens and may provide an early indication of therapy effectiveness.

• Journal of Plant Biotechnology
• /
• 제43권1호
• /
• pp.76-81
• /
• 2016

We performed a molecular marker-based analysis of quantitative trait loci for traits that determine the quality of appearance of grains using 120 doubled haploid lines developed by anther culture from the F1 cross between 'Cheongcheong' (Oryza sativa L. ssp. Indica) and 'Nagdong' (Oryza sativa L. ssp. Japonica). We therefore calculated the alkali digestion value (ADV), used to indirectly measure gelatinization temperature, to evaluate the quality of cooked rice in 2013 and 2014. The ADV score of frequency distribution was higher milled rice than brown rice. In total, nine different quantitative trait loci (QTLs) were found on 5 chromosomes in 2013 and 2014. Also, chromosome 5, 8 were detected over two years. We conclude that selected molecular markers from this QTL analysis could be exploited in future rice quality. In conclusion, we investigated ADV of brown and milled rice in CNDH population. This study found nine QTLs related to the ADV of brown and milled rice. The detected one marker can be used to select lines with desirable eating-quality traits because ADV is closely associated with the eating quality of cooked rice. Therefore, it will be useful to collect resources and distinguishable in many varieties for rice breeding program.

• Biotechnology and Bioprocess Engineering:BBE
• /
• 제9권3호
• /
• pp.217-222
• /
• 2004

As Agrobacterium tumefaciens, which has long been used to transform plants, is known to transfer T-DNA to budding yeast, Saccharomyces cerevisiae, a variety of fungi were subjected to the A. tumefaciens-mediated transformation to improve their transformation frequency and feasibility. The A. tumefaciens-mediated transformation of chestnut blight fungus, Cryphonectria parasitica, is performed in this study as the first example of transformation of a hardwood fungal pathogen. The transfer of the binary vector pBIN9-Hg, containing the bacterial hygromycin B phosphotransferase gene under the control of the Aspergillus nidulans trpC promoter and terminator, as a selectable marker, led to the selection of more than 1,000 stable, hygromycin B-resistant transformants per 1${\times}$10$\^$6/ conidia of C. parasitica. The putative transformants appeared to be mitotically stable. The transformation efficiency appears to depend on the bacterial strain, age of the bacteria cell culture and ratio of fungal spores to bacterial cells. PCR and Southern blot analysis indicated that the marker gene was inserted at different chromosomal sites. Moreover, three transformants out of ten showed more than two hybridizing bands, suggesting more than two copies of the inserted marker gene are not uncommon.

• Journal of Microbiology
• /
• 제39권1호
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.