• Title/Summary/Keyword: Marker-set

Search Result 249, Processing Time 0.02 seconds

Development of SNP marker set for marker-assisted backcrossing (MABC) in cultivating tomato varieties

  • Park, GiRim;Jang, Hyun A;Jo, Sung-Hwan;Park, Younghoon;Oh, Sang-Keun;Nam, Moon
    • Korean Journal of Agricultural Science
    • /
    • v.45 no.3
    • /
    • pp.385-400
    • /
    • 2018
  • Marker-assisted backcrossing (MABC) is useful for selecting offspring with a highly recovered genetic background for a recurrent parent at early generation unlike rice and other field crops. Molecular marker sets applicable to practical MABC are scarce in vegetable crops including tomatoes. In this study, we used the National Center for Biotechnology Information- short read archive (NCBI-SRA) database that provided the whole genome sequences of 234 tomato accessions and selected 27,680 tag-single nucleotide polymorphisms (tag-SNPs) that can identify haplotypes in the tomato genome. From this SNP dataset, a total of 143 tag-SNPs that have a high polymorphism information content (PIC) value (> 0.3) and are physically evenly distributed on each chromosome were selected as a MABC marker set. This marker set was tested for its polymorphism in each pairwise cross combination constructed with 124 of the 234 tomato accessions, and a relatively high number of SNP markers polymorphic for the cross combination was observed. The reliability of the MABC SNP set was assessed by converting 18 SNPs into Luna probe-based high-resolution melting (HRM) markers and genotyping nine tomato accessions. The results show that the SNP information and HRM marker genotype matched in 98.6% of the experiment data points, indicating that our sequence analysis pipeline for SNP mining worked successfully. The tag-SNP set for the MABC developed in this study can be useful for not only a practical backcrossing program but also for cultivar identification and F1 seed purity test in tomatoes.

CAPS Marker Linked to Tomato Hypocotyl Pigmentation

  • Kim, Hyoun-Joung;Lee, Heung-Ryul;Hyun, Ji-Young;Won, Dong-Chan;Hong, Dong-Oh;Harn, Chee-Hark
    • Horticultural Science & Technology
    • /
    • v.30 no.1
    • /
    • pp.56-63
    • /
    • 2012
  • Tomato hypocotyl can generally be one of two colors, purple or green. Genetically, this trait is controlled by a single dominant gene. Hypocotyl tissue specific color expression is one of many visible genetic marker sources used to select tomato progeny. However, the visible marker does not show a clear distinction between homozygous genotype and heterozygous genotype from the breeding lines. Therefore, to identify a hypocotyl pigmentation related marker, we screened DNA polymorphisms in thirteen tomato lines showing purple or green hypocotyls. The markers used for screening consisted of primer set information obtained from anthocyanin related genes, conserved ortholog set II (COS II) marker sets localized near anthocyanin related genes, and restriction fragment length polymorphism (RFLP) markers localized near COS II markers, which produce polymorphisms between purple and green tomatoes. One primer from a RFLP fragment resulted in a polymorphism on agarose gel electrophoresis. From the RFLP fragment, a cleaved amplified polymorphic sequence (CAPS) marker was developed to distinguish between purple and green hypocotyls. The genotypes of 135 $F_2$ individuals were analyzed using the CAPS marker, and among them, 132 individuals corresponded to the phenotypes of hypocotyl pigmentation.

Characterization of microsatellite markers covering chromosome 1 in the Korean and Japanese populations (한국인과 일본인에서 1번 염색체에 부착되는 microsatellite marker의 특징)

  • Lee, You-Jin;Park, Soo-Byung
    • The korean journal of orthodontics
    • /
    • v.34 no.6 s.107
    • /
    • pp.537-543
    • /
    • 2004
  • Microsatellit markers are considered to be very promising genetic markers for genetic linkage analysis. The majority of the markers are as informative as in Caucasians but there are significant ethnic differences in the genetic variations. In order to investigate the genetic variations in the Korean and Japanese populations and their ethnic differences, 51 microsatellite marker loci spanning the whole human chromosome 1 were arranged from a commercially available set (ABI PRISM Linkage Mapping Set-HD5, Applied Biosystems, Foster City, CA, USA), and then determined the allelic frequencies and heterozygosities for these marker loci in the 90 unrelated Korean subjects and 90 unrelated Japanese subjects. Of all 51 markers tested, significant differences were observed when microsatellite allele frequency pattern of Korean was compared with those of Caucasian, while this pattern was highly similar between Korean and Japanese populations. Our data indicate that an extensive verification of public microsatellite markers in a particular population study should be undertaken prior to their linkage studies. Moreover, this information should facilitate genetic linkage studies of various hereditary diseases, especially in the Koreans and Japanese.

'Cikum' and Aspects in Korean (국어에서의 '지금'과 상)

  • Yeom, Jae-Il
    • Language and Information
    • /
    • v.16 no.2
    • /
    • pp.43-66
    • /
    • 2012
  • In this paper, I attempt to define the semantics of cikum 'now' in Korean. To define it precisely, we need to look at how it interacts with different aspectual classes of verbs and with the semantics of tenses and aspects. In doing this we need to define the semantics of tenses and aspects. Here we run into the question of whether ess is a tense marker or an aspect marker. I assume that it is ambiguous. There are still cases where it is not clear whether ess is used as a tense marker or an aspect marker in an actual sentence. I discuss two such cases: one in which it is used with verbs like tochakha 'arrive' which have no salient resulting states, and one in which a state verb is used with cikum-kkaci 'until now'. The semantics of cikum can be defined differently depending on whether ess is a tense or an aspect. By discussing ko iss, which is an imperfect marker, I conclude that cikum means ${\lambda}P{\lambda}i[u{\subseteq}i{\wedge}P(i)]$, that is, a relation between a set of times which include an utterance time and a set of properties of times.

  • PDF

Development of SNP Markers for Domestic Pork Traceability (국내산 돼지고기의 원산지 검증을 위한 SNP Marker Set 개발)

  • Kim, Sang-Wook;Li, Xiaoping;Lee, Yun-Mi;Kim, Jong-Joo;Kim, Tae-Hun;Choi, Bong-Hwan;Kim, Kwan-Suk
    • Journal of Animal Science and Technology
    • /
    • v.52 no.2
    • /
    • pp.91-96
    • /
    • 2010
  • The purpose of the study was to develop an optimum SNP marker set to be utilized for domestic pork traceability. The study tested 51 SNP markers analyzed for origin of farm to be determined from genotypes of offspring and parents in pigs. With the simulation data through random mating population (PI), half sib mating population ($PI_{half-sib}$) and full sib mating population ($PI_{sibs}$), probability of identical genotypes were analyzed as $5.63{\times}10^{-33}$, $4.35{\times}10^{-15}$ and $1.32{\times}10^{-15}$, respectively. The 51 SNP markers also had 100% accuracy for parental determination. These results suggest that if the pig breeding stock is genotyped with the 51 SNP markers, the genotype information of individual offspring can be checked for farm origins by tracing parental sow and sire. Therefore, these SNP markers will be useful to trace the pork from production to consumption in pigs.

Analysis of Marker Efficiency According to Blouse Sleeve Design (블라우스의 소매 디자인에 따른 마커 효율에 관한 연구)

  • Park, Woo-Mee
    • Journal of the Korean Home Economics Association
    • /
    • v.48 no.2
    • /
    • pp.85-94
    • /
    • 2010
  • Comparative analysis of marker efficiency in blouse patterns, based on different sleeve designs, was carried out. Sleeve designs used included set-in-sleeve, laglan sleeve, and epaulet sleeve. The two types of epaulet sleeves, A and B, are based on pattern arrangement methods of center back. Cloth and production conditions are the width of cloth, the number of marking pieces, and the direction for marking deployment. A blouse pattern saved to the PAD CAD System was graded with different sizes and arranged for industrial purpose to calculate the marker efficiency in different conditions. The results were as follows. On the whole, the marker efficiency of small pattern sized set-insleeve was higher than laglan and epaulet sleeve designs. It was also established that marker efficiency is dependent on cloth and production conditions. For small number of marking pieces, efficiency was higher in the condition of 110cm cloth widths compared with that condition of 150cm cloth widths. However the efficiency of large number of marking pieces was higher in the condition of 150cm cloth widths.

Discrimination of Bacillus anthracis from Bacillus cereus Group Using KHT5 Marker (KHT5 마커를 사용한 Bacillus cereus 그룹에서 Bacillus anthracis의 구별)

  • 김형태;김성주;채영규
    • Korean Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.40-44
    • /
    • 2003
  • Bacillus anthracis is a gram-positive spore-forming bacterium that causes the disease anthrax. In order to develop a DNA marker specific for Bacillus anthracis and to discriminate this species from Bacillus cereus group, we applied the randomly amplified polymorphic DNA (RAPD)-PCR technique to a collection of 29 strains of the genus Bacillus, including 22 species of the B. cereus group. A 709-bp RAPD marker (KHT5) specific for B. anthracis was obtained from B. anthracis BAK. The PCR product of internal primer set from the KHT5 fragment distinguished B. anthracis from the other species of the B. cereus group.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Contrastive Topic In Vietnamese

  • Ba, Nguyen Hoai Thu;Lee, Chung-Min
    • Annual Conference on Human and Language Technology
    • /
    • 2004.10d
    • /
    • pp.323-328
    • /
    • 2004
  • The main concern of the paper is to establish a hypothesis in which the form thi is treated as a particular Contrastive Topic marker in Vietnamese sentence structure. We have investigated that the form thican be placed after a topical nominal or verbal to compose a Contrastive Topic phrase. Not only the subjects or objects but predicates in Vietnamese can have a CT interpretation with the marker thi. The thi-phrase not only refers to an entity or event the speaker wants to talk about, but also indicates that there exist contrastive alternatives the speaker wants to talk about. The nature of the contrastive topic decides the nature the alternative set and the choice of the topic of the implicated proposition. When the set of alternatives does not have the characteristic of scale, we have a descriptive opposite implicature. Again, if the contrastive set is a scalar set, we gat a denial-of expectation implicature.

  • PDF