Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
As robots are considered one of the mainstream digital transformations, robots with machine vision becomes a main area of study providing the ability to check what robots watch and make decisions based on it. However, it is difficult to find a small object in the image mainly due to the flaw of the most of visual recognition networks. Because visual recognition networks are mostly convolution neural network which usually consider local features. So, we make a model considering not only local feature, but also global feature. In this paper, we propose a detection method of a small marker on the object using deep learning and an algorithm that considers global features by combining Transformer's self-attention technique with a convolutional neural network. We suggest a self-attention model with new definition of Query, Key and Value for model to learn global feature and simplified equation by getting rid of position vector and classification token which cause the model to be heavy and slow. Finally, we show that our model achieves higher mAP than state of the art model YOLOr.
Reconstruction of the three-dimensional (3D) environment is a key aspect of augmented reality and augmented virtuality, which utilize and incorporate a user's surroundings. Such reconstruction can be easily realized by employing a Kinect device. However, multiple Kinect devices are required for enhancing the reconstruction density and for spatial expansion. While employing multiple Kinect devices, they must be calibrated with respect to each other in advance, and a marker is often used for this purpose. However, a marker needs to be placed at each calibration, and the result of marker detection significantly affects the calibration accuracy. Therefore, a user-friendly, efficient, accurate, and marker-less method for calibrating multiple Kinect devices is proposed in this study. The proposed method includes a joint tracking algorithm for approximate calibration, and the obtained result is further refined by applying the iterative closest point algorithm. Experimental results indicate that the proposed method is a convenient alternative to conventional marker-based methods for calibrating multiple Kinect devices. Hence, the proposed method can be incorporated in various applications of augmented reality and augmented virtuality that require 3D environment reconstruction by employing multiple Kinect devices.
TOLED(Transparent, Organic Light Emitting Diodes) based edutainment system has been studied to solve the actual feeling training and educational experience problem of e-learning. However, edutainment system using TOLED has a problem for the non-detection of multi marker array and rotate marker array, and it has problem for the dissonance phenomena caused by Illumination Environment between real world and virtual object. It also has a do not provide services through a variety of devices problem. Therefore, in this paper, we designed a system that provides a realistic actual feeling edutainment contents by recognizes the marker array rotation and a plurality of marker arrangement via an improved marker detection technique. And to unify the real space and virtual space of the lighting environment through a nested block layer.
Background: Epidural test doses containing epinephrine are an incomplete marker for the detection of inadvertent intravascular injection. Therefore, many investigators have attempted to find a more reliable marker as an alternative to epinephrine in adult patients anesthetized with enflurane. The present study was designed to test whether two different simulated intravenous test doses of isoproterenol could be used as a reliable marker for the detection of inadvertent intravascular injection in adult patients anesthetized with $O_2-N_2O$-enflurane. Methods: Forty healthy adult patients were anesthetized with 1% end-tidal enflurane and nitrous oxide after endotracheal intubation and were randomized to one of two groups according to the dose of isoproterenol. Group 1 and 2 (n = 20 each) received 3 ml of 1.5% lidocaine with 3 and 5 g isoproterenol intravenously, respectively, to simulate an intravascularly administered test dose. Heart rate (HR) and systolic blood pressure (SBP) were measured at 20-second intervals for 4 min after injection. Results: Mean maximal HR increases were $24{\pm}17$, $35{\pm}11$ bpm (P < 0.05), mean maximal SBP increases were $14{\pm}8$, $13{\pm}9$ mmHg and mean maximal SBP decreases $20{\pm}11$, $22{\pm}9$ mmHg following the IV injection of 3, $5{\mu}g$ isoproterenol, respectively. The incidence of hypotension was similar in both groups. Isoproterenol 3 and $5{\mu}g$ produced 75%, 100% sensitivity in the HR criteria ($\geq$ 20 bpm increase) and 60%, 70% sensitivity in the SBP criteria ($\geq$ 15 mmHg), respectively. Conclusions: These results indicate that based on the HR response, the epidural test dose containing $5{\mu}g$ isoproterenol to simulate an intravascular administration is a more reliable marker than $3{\mu}g$ isoproterenol in adult healthy patients during enflurane anesthesia.
Park, Jaehyuk;Cho, Dong Youn;Moon, Jin Seong;Yoon, Moo-Kyoung;Kim, Sunggil
Horticultural Science & Technology
/
v.31
no.1
/
pp.72-79
/
2013
Inactivation of the gene coding for dihydroflavonol 4-reductase (DFR) is responsible for the color difference between red and yellow onions (Allium cepa L.). Two inactive DFR-A alleles, DFR-$A^{PS}$ and DFR-$A^{DEL}$, were identified in our previous study. A functional marker was developed on the basis of the premature stop codon that inactivated the DFR-$A^{PS}$ allele. A derived cleaved amplified polymorphic sequences (dCAPS) primer was designed to detect the single nucleotide polymorphism, an A/T transition, which produced the premature stop codon. Digested PCR products clearly distinguished the homozygous and heterozygous red $F_2$ individuals. Meanwhile, to develop a molecular marker for detection of the DFR-$A^{DEL}$ allele in which entire DFR-A gene was deleted, genome walking was performed and approximately 3 kb 5' and 3' flanking sequences of the DFR-$A^R$ coding region were obtained. PCR amplification using multiple primers binding to the extended flanking regions showed that more of the extended region of the DFR-A gene was deleted in the DFR-$A^{DEL}$ allele. A dominant simple PCR marker was developed to identify the DFR-$A^{DEL}$ allele using the dissimilar 3' flanking sequences of the DFR-A gene and homologous DFR-B pseudogene. Distribution of the DFR-$A^{PS}$ and DFR-$A^{DEL}$ alleles in yellow onion cultivars bred in Korea and Japan was surveyed using molecular makers developed in this study. Results showed predominant existence of the DFR-$A^{PS}$ allele in yellow onion cultivars.
Although big-sized markers are good for accurate marker recognition and tracking, they are easily occluded by other objects and deteriorate natural visualization and level of immersion during user interaction in AR environments. In this paper, we propose an approach to exploiting the use of rectangular markers to support tangible AR interaction based on fingertip touch using small-sized markers. It basically adjusts the length, width, and interior area of rectangular markers to make them more suitably fit to longish objects like fingers. It also utilizes convex polygons to resolve the partial occlusion of a marker and properly enlarges the pattern area of a marker while adjusting its size without deteriorating the quality of marker detection. We obtained encouraging results from users that the approach can provide better natural visualization and higher level of immersion, and be accurate and tangible enough to support a pseudo feeling of touching virtual products with human hands or fingertips during design evaluation of digital handheld products.
A method for mapping quantitative trait loci (QTL) was introduced incorporating the information of mixed progeny from complex pedigrees. The method consisted of two steps based on single marker analysis. The first step was to examine the marker-trait association with a mixed model considering common environmental effect and reversed QTL-marker linkage phase. The second step was to estimate QTL effects by a weighted least square analysis. A simulation study indicated that the method incorporating mixed progeny from multiple generations improved the accuracy of QTL detection. The influence of within-genotype variance and recombination rate on QTL analysis was further examined. Detecting a QTL with a large within-genotype variance was more difficult than with a small within-genotype variance. Most of the significant marker-QTL association was detectable when the recombination rate was less than 15%.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.