• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• The Journal of Korea Robotics Society
• /
• v.17 no.4
• /
• pp.425-430
• /
• 2022

As robots are considered one of the mainstream digital transformations, robots with machine vision becomes a main area of study providing the ability to check what robots watch and make decisions based on it. However, it is difficult to find a small object in the image mainly due to the flaw of the most of visual recognition networks. Because visual recognition networks are mostly convolution neural network which usually consider local features. So, we make a model considering not only local feature, but also global feature. In this paper, we propose a detection method of a small marker on the object using deep learning and an algorithm that considers global features by combining Transformer's self-attention technique with a convolutional neural network. We suggest a self-attention model with new definition of Query, Key and Value for model to learn global feature and simplified equation by getting rid of position vector and classification token which cause the model to be heavy and slow. Finally, we show that our model achieves higher mAP than state of the art model YOLOr.

• Journal of Korea Multimedia Society
• /
• v.22 no.10
• /
• pp.1142-1148
• /
• 2019

Reconstruction of the three-dimensional (3D) environment is a key aspect of augmented reality and augmented virtuality, which utilize and incorporate a user's surroundings. Such reconstruction can be easily realized by employing a Kinect device. However, multiple Kinect devices are required for enhancing the reconstruction density and for spatial expansion. While employing multiple Kinect devices, they must be calibrated with respect to each other in advance, and a marker is often used for this purpose. However, a marker needs to be placed at each calibration, and the result of marker detection significantly affects the calibration accuracy. Therefore, a user-friendly, efficient, accurate, and marker-less method for calibrating multiple Kinect devices is proposed in this study. The proposed method includes a joint tracking algorithm for approximate calibration, and the obtained result is further refined by applying the iterative closest point algorithm. Experimental results indicate that the proposed method is a convenient alternative to conventional marker-based methods for calibrating multiple Kinect devices. Hence, the proposed method can be incorporated in various applications of augmented reality and augmented virtuality that require 3D environment reconstruction by employing multiple Kinect devices.

• Proceedings of the Zoological Society Korea Conference
• /
• 1997.04a
• /
• pp.37-39
• /
• 1997

• Clinical and Experimental Pediatrics
• /
• v.64 no.1
• /
• pp.28-30
• /
• 2021

• Journal of the Korea Convergence Society
• /
• v.6 no.3
• /
• pp.103-109
• /
• 2015

TOLED(Transparent, Organic Light Emitting Diodes) based edutainment system has been studied to solve the actual feeling training and educational experience problem of e-learning. However, edutainment system using TOLED has a problem for the non-detection of multi marker array and rotate marker array, and it has problem for the dissonance phenomena caused by Illumination Environment between real world and virtual object. It also has a do not provide services through a variety of devices problem. Therefore, in this paper, we designed a system that provides a realistic actual feeling edutainment contents by recognizes the marker array rotation and a plurality of marker arrangement via an improved marker detection technique. And to unify the real space and virtual space of the lighting environment through a nested block layer.

• The Korean Journal of Pain
• /
• v.14 no.2
• /
• pp.186-192
• /
• 2001

Background: Epidural test doses containing epinephrine are an incomplete marker for the detection of inadvertent intravascular injection. Therefore, many investigators have attempted to find a more reliable marker as an alternative to epinephrine in adult patients anesthetized with enflurane. The present study was designed to test whether two different simulated intravenous test doses of isoproterenol could be used as a reliable marker for the detection of inadvertent intravascular injection in adult patients anesthetized with $O_2-N_2O$-enflurane. Methods: Forty healthy adult patients were anesthetized with 1% end-tidal enflurane and nitrous oxide after endotracheal intubation and were randomized to one of two groups according to the dose of isoproterenol. Group 1 and 2 (n = 20 each) received 3 ml of 1.5% lidocaine with 3 and 5 g isoproterenol intravenously, respectively, to simulate an intravascularly administered test dose. Heart rate (HR) and systolic blood pressure (SBP) were measured at 20-second intervals for 4 min after injection. Results: Mean maximal HR increases were $24{\pm}17$, $35{\pm}11$ bpm (P < 0.05), mean maximal SBP increases were $14{\pm}8$, $13{\pm}9$ mmHg and mean maximal SBP decreases $20{\pm}11$, $22{\pm}9$ mmHg following the IV injection of 3, $5{\mu}g$ isoproterenol, respectively. The incidence of hypotension was similar in both groups. Isoproterenol 3 and $5{\mu}g$ produced 75%, 100% sensitivity in the HR criteria ($\geq$ 20 bpm increase) and 60%, 70% sensitivity in the SBP criteria ($\geq$ 15 mmHg), respectively. Conclusions: These results indicate that based on the HR response, the epidural test dose containing $5{\mu}g$ isoproterenol to simulate an intravascular administration is a more reliable marker than $3{\mu}g$ isoproterenol in adult healthy patients during enflurane anesthesia.

• Horticultural Science & Technology
• /
• v.31 no.1
• /
• pp.72-79
• /
• 2013

Inactivation of the gene coding for dihydroflavonol 4-reductase (DFR) is responsible for the color difference between red and yellow onions (Allium cepa L.). Two inactive DFR-A alleles, DFR-$A^{PS}$ and DFR-$A^{DEL}$, were identified in our previous study. A functional marker was developed on the basis of the premature stop codon that inactivated the DFR-$A^{PS}$ allele. A derived cleaved amplified polymorphic sequences (dCAPS) primer was designed to detect the single nucleotide polymorphism, an A/T transition, which produced the premature stop codon. Digested PCR products clearly distinguished the homozygous and heterozygous red $F_2$ individuals. Meanwhile, to develop a molecular marker for detection of the DFR-$A^{DEL}$ allele in which entire DFR-A gene was deleted, genome walking was performed and approximately 3 kb 5' and 3' flanking sequences of the DFR-$A^R$ coding region were obtained. PCR amplification using multiple primers binding to the extended flanking regions showed that more of the extended region of the DFR-A gene was deleted in the DFR-$A^{DEL}$ allele. A dominant simple PCR marker was developed to identify the DFR-$A^{DEL}$ allele using the dissimilar 3' flanking sequences of the DFR-A gene and homologous DFR-B pseudogene. Distribution of the DFR-$A^{PS}$ and DFR-$A^{DEL}$ alleles in yellow onion cultivars bred in Korea and Japan was surveyed using molecular makers developed in this study. Results showed predominant existence of the DFR-$A^{PS}$ allele in yellow onion cultivars.

• Journal of Computational Design and Engineering
• /
• v.1 no.4
• /
• pp.289-297
• /
• 2014

Although big-sized markers are good for accurate marker recognition and tracking, they are easily occluded by other objects and deteriorate natural visualization and level of immersion during user interaction in AR environments. In this paper, we propose an approach to exploiting the use of rectangular markers to support tangible AR interaction based on fingertip touch using small-sized markers. It basically adjusts the length, width, and interior area of rectangular markers to make them more suitably fit to longish objects like fingers. It also utilizes convex polygons to resolve the partial occlusion of a marker and properly enlarges the pattern area of a marker while adjusting its size without deteriorating the quality of marker detection. We obtained encouraging results from users that the approach can provide better natural visualization and higher level of immersion, and be accurate and tangible enough to support a pseudo feeling of touching virtual products with human hands or fingertips during design evaluation of digital handheld products.

• Asian-Australasian Journal of Animal Sciences
• /
• v.14 no.11
• /
• pp.1505-1510
• /
• 2001

A method for mapping quantitative trait loci (QTL) was introduced incorporating the information of mixed progeny from complex pedigrees. The method consisted of two steps based on single marker analysis. The first step was to examine the marker-trait association with a mixed model considering common environmental effect and reversed QTL-marker linkage phase. The second step was to estimate QTL effects by a weighted least square analysis. A simulation study indicated that the method incorporating mixed progeny from multiple generations improved the accuracy of QTL detection. The influence of within-genotype variance and recombination rate on QTL analysis was further examined. Detecting a QTL with a large within-genotype variance was more difficult than with a small within-genotype variance. Most of the significant marker-QTL association was detectable when the recombination rate was less than 15%.