• Mycobiology
• /
• v.45 no.4
• /
• pp.327-337
• /
• 2017

Three new records of Ascomycota species (Chaetomium acropullum, Phialemonium globosum, Phialemonium atrogriseum) from field soils in Korea are presented in this study. These newly discovered fungal isolates were isolated from field soils from various places across Gyeongnam, Korea in 2016. All the isolates were identified and described based on morphological characteristics, and rDNA internal transcribed spacer and ${\beta}$-tubulin gene sequence data. Morphological features of these fungal species were studied on different agar media: potato dextrose agar, oatmeal agar, malt extract agar, Czapek yeast extract agar, and yeast extract sucrose agar. Full description and illustrations of their morphological characters are provided. These fungal species have not officially been previously reported in Korea.

• The Korean Journal of Mycology
• /
• v.47 no.3
• /
• pp.187-197
• /
• 2019

Ascomycota is the largest phylum of the Fungi, including approximately 6,600 genera. They are often isolated from soils, indoor air, and freshwater environments, but also from plants as pathogens or endophytes. In this study, four species of Ascomycota (two of Cladosporium and one of each Daldinia and Nigrospora) were collected from the leaves of four woody plants (Camellia japonica, Ginkgo biloba, Quercus sp., Vitis vinifera). Their cultural characteristics were investigated on five different media (PDA, V8A, CMA, MEA, CZA) at 3 days after incubation at $25^{\circ}C$ in darkness. BLASTn search and phylogenetic analysis were performed using the internal transcribed spacer (ITS) rDNA sequences, in addition to tef1 gene sequences for Cladosporium species. Based on the cultural, morphological, and phylogenetic data, the isolates were identified as Cladosporium anthropophilum, Cladosporium pseudocladosporioides, Daldinia eschscholtzii, and Nigrospora chinensis. Previously, some members of Cladosporium and Nigrospora have been recorded as endophytes inhabiting the leaves and stems of various plants, whereas Daldinia eschscholtzii is a wood-inhabiting endophyte or wood-decaying fungus. To our knowledge, this is the first report of these four ascomycetes in Korea.

• The Korean Journal of Mycology
• /
• v.47 no.2
• /
• pp.105-112
• /
• 2019

A unrecorded species of Trichocladium, Trichocladium griseum, was isolated in 2017 during a survey of fungal diversity in Ulsan province, South Korea. This species was identified based on morphological characteristics and phylogenetic analysis of the internal transcribed spacer (ITS) rDNA and ${\beta}-tubulin$ gene sequences. T. griseum has not yet been reported in South Korea. Thus, we report for the first time a new record of Trichocladium griseum in Korea, and we include the descriptions and morphological illustrations of this fungus.

• ALGAE
• /
• v.37 no.3
• /
• pp.185-204
• /
• 2022

The genus Coolia A. Meunier 1919 has a global distribution and is a common member of epiphytic dinoflagellate assemblages in neritic ecosystems. Coolia monotis is the type species of the genus and was the only known species for 76 years. Over the past few decades, molecular characterization has unveiled two species complexes that group morphologically very similar species, so their limits are often unclear. To provide new knowledge on the biogeography and species composition of the genus Coolia, 16 strains were isolated from Bahía de La Paz, Gulf of California. The species were identified by applying morphological and molecular approaches. The morphometric characteristics of all isolated Coolia species were consistent with the original taxa descriptions. Phylogenetic analyses (large subunit [LSU] rDNA D1 / D2 and internal transcribed spacer [ITS] 1 / 5.8S / ITS2) revealed a species assemblage comprising Coolia malayensis, C. palmyrensis, C. tropicalis, and the C. cf. canariensis lineage. This is the first report of Coolia palmyrensis and C. cf. canariensis in Mexico and C. tropicalis in the Gulf of California. Our results strengthen the biogeographical understanding of these potentially harmful epiphytic dinoflagellate species.

• The Korean Journal of Mycology
• /
• v.50 no.3
• /
• pp.195-204
• /
• 2022

A fungal strain, designated KNUF-20-NI009, was isolated from soil collected from Gunsan-si, Jeollabuk-do, Korea. The isolate showed cultural features typical of the genus Xenoroussoella. Colonies cultivated on malt extract agar were olivaceous-brown to pale olivaceous-white at the margins, with undersides of dark olivaceous to olivaceous-brown and a white margin. The conidia, with a size range of 2.7-5.1×1.6-3.3 ㎛ ($\bar{x}=3.6\times2.6{\mu}m$, n=50), were globoid to ellipsoid in shape, hyaline when immature, becoming light brown to golden-brown when mature, and characterized by 1 or 2 guttules. Multi-locus sequence analysis based on a combined dataset of internal transcribed spacer regions (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU), translation elongation factor 1-alpha (TEF1α), and RNA polymerase II largest subunit (RPB2) sequences revealed KNUF-20-NI009 to be a strain of Xenoroussoella triseptata. This is the first report of this species in Korea.

• Research in Plant Disease
• /
• v.29 no.2
• /
• pp.130-136
• /
• 2023

Citrus melanoses caused by Diaporthe citri, has been one of the serious diseases in many citrus orchards of Jeju Island. To protect melanose in citrus farms, a fast and exact diagnosis method is necessary. In this study, diseased leaves and dieback twigs were collected from a total of 49 farms within March to April in 2022. A total of 465 fungal isolates were obtained from a total of 358 isolated plant samples. Among these fungal isolates, 40 representatives of D. citri isolates which were isolated from 22 twigs and 18 leaves on 23 farms were found based on cultural characteristics on potato dextrose agar and conidial morphology. Additionally, the molecular assay was carried out and compared with those by morphological diagnosis. All isolates were identified as D. citri by analyzing the sequences at the internal transcribed spacer (ITS) rDNA region using primers of ITS1/ITS4 or at β-tubulin using primer Btdcitri-F/R. Therefore, based on the present study, where the results of morphological identification of conidial type were consistent with DNA sequence analysis of certain gene, choosing a suitable method for a fast diagnosis of citrus melanose was suggested.

• Korean journal of applied entomology
• /
• v.42 no.1
• /
• pp.65-70
• /
• 2003

For the purpose of the protection of beneficial insects from pathogens and the development of control agent against pests, a strain of Metarhizium sp. was isolated from the infected Protaetia brevitarsis seulensis larvae in Korea. Under the scanning electron microscope, the isolate, Metarhizium sp. KMA-1, showed distinct formation of conidia on the palisade-like masse which were comprised of elongate chains and this shape is a typical feature of Metarhizium species. PCR techniques were used to identify the isolate and the primers used were designed on the basis of two kinds of rRNAs sequences, 28S rRNA and internal transcribed spacer(ITS). The specific PCR products from each primer set were amplified and the DNA sequences were determined for the similarity comparison. Sequence alignment of these fragments using GenBank database resulted in the highest homology similarity between the isolate Metarhizium sp. KMA-1 and M. anisopliae. From these results, the isolate Metarhizium sp. KMA-1 in this study was identified as M. anisopliae.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Mycobiology
• /
• v.40 no.2
• /
• pp.129-133
• /
• 2012

A new disease, the slippery scar, was investigated in cultivated bags of Auricularia polytricha. This fungus was isolated from the infected mycelia of cultivated bags. Based on morphological observation, rDNA-internal transcribed spacer and 18S sequence analysis, this pathogen was identified as the Ascomycete Scytalidium lignicola. According to Koch's Postulation, the pathogenicity of S. lignicola to the mycelia of A. polytricha was confirmed. The parasitism of this fungus on mushroom mycelia in China has not been reported before.

• Mycobiology
• /
• v.42 no.1
• /
• pp.82-85
• /
• 2014

During an investigation of microorganisms and pests in plant culture media from imported anthurium pots, a fungal isolate (DUCC4002) was detected. Based on its morphological characters including colony shape on potato dextrose agar, the microstructures of spores observed by light and scanning electron microscopy and the results of phylogenetic analysis using an internal transcribed spacer rDNA sequence, the fungal isolate was identified as Myrothecium roridum. Pathogenicity testing on anthurium leaves revealed that the fungus could colonize and produce sporodochia on the inoculated leaves. This is the first report of M. roridum detected in imported plant culture medium in Korea.