• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• Korean Journal of Plant Taxonomy
• /
• v.34 no.2
• /
• pp.173-183
• /
• 2004

한국산 미나리아재비속 미나리아재비(Acris Schur)절에 속하는 미나리아재비(Ranunculus japonicus)와 근연종인 산미나리아재비(R. acris var. nipponicus) 및 바위미나리아재비(R. crucilobus)의 실체와 분류학적 한계를 파악하기위해 속, 종간 규명에 많이 이용하고 있는 핵리보좀(ribosomal) DNA의 internal transcribed spacer 구간의 염기서열을 분석하였다. 본 연구는 6개의 군외군을 포함하여 총 18개의 DNA 재료(accessions)의 정열된 염기서열들을 바탕으로 bootsrap을 포함한 maximum parsimony와 maximum likelihood 분석법에 의한 계통수로 평가하였다. 연구 결과 Acris절에 속하는 미나리아재비, 산미나리아재비 및 바위미나리아재비는 단계통군으로 나타났으며 특히 미나리아재비(R. japonicus)와 산미나리아재비(R. acris var. nipponicus)는 같은 분계조를 형성하였다. 이와 달리 바위미나리아재비는 미나리아재비와 산미나리아재비에서 분지된 결과를 보여, 한라산 해발 1500m이상의 높은 지역에 분포하는 바위미나리아재비는 미나리아재비의 아종(R. japonicus Thunb. subsp. chrysotrichus (Nakai) Y. N. Lee, comb. nud.)으로 처리하기보다는, 독립된 고유종인 R. crucilobus H. L$\acute{e}$v.으로의 처리를 지지하였다.

• Mycobiology
• /
• v.49 no.5
• /
• pp.498-506
• /
• 2021

An endophytic fungus strain DYSJ3 was isolated from a stem of Aphanamixis grandifolia Blume, which was identified as Aspergillus versicolor based on the morphological characteristics, internal transcribed spacer (ITS) and calmodulin gene sequences analyses. A. versicolor DYSJ3 exhibited strong antagonistic activity against Colletotrichum musae, C. gloeosporioides and Fusarium oxysporum f. sp. cubense with the inhibition rates of 61.9, 51.2 and 55.3% respectively. The antifungal metabolites mainly existed in the mycelium of A. versicolor DYSJ3, and its mycelial crude extract (CE) had broad-spectrum antifungal activities against plant pathogenic fungi. The CE had a good thermal stability, and the inhibition rate of 100 mg/mL CE against C. musae was above 70.0% after disposing at 120 ℃ for 1 h. Five secondary metabolites were isolated from the CE and identified as averufanin, ergosterol peroxide, versicolorin B, averythrin and sterigmatocystin. Activity evaluation showed versicolorin B exhibited inhibitory effects on the mycelial growth and conidial germination of C. musae, and sterigmatocystin had a weak inhibitory effect on the mycelial growth of C. musae.

• The Korean Journal of Mycology
• /
• v.51 no.2
• /
• pp.127-133
• /
• 2023

We report the first discovery of Penicillium mexicanum in Korea. Fungal strains were isolated from air samples collected in Taean-gun, Chungcheongnam-do, Korea. The strain was identified based on its morphological characteristics, as well as molecular phylogenetic analysis of the internal transcribed spacer (ITS), β-tubulin (BenA), and calmodulin (CaM) regions. This strain exhibited a high sequence similarity to the reference sequences of P. mexicanum. These findings enhance our understanding of fungal biodiversity in Korea and underscore the importance of continuous monitoring of fungal species.

• ALGAE
• /
• v.37 no.3
• /
• pp.185-204
• /
• 2022

The genus Coolia A. Meunier 1919 has a global distribution and is a common member of epiphytic dinoflagellate assemblages in neritic ecosystems. Coolia monotis is the type species of the genus and was the only known species for 76 years. Over the past few decades, molecular characterization has unveiled two species complexes that group morphologically very similar species, so their limits are often unclear. To provide new knowledge on the biogeography and species composition of the genus Coolia, 16 strains were isolated from Bahía de La Paz, Gulf of California. The species were identified by applying morphological and molecular approaches. The morphometric characteristics of all isolated Coolia species were consistent with the original taxa descriptions. Phylogenetic analyses (large subunit [LSU] rDNA D1 / D2 and internal transcribed spacer [ITS] 1 / 5.8S / ITS2) revealed a species assemblage comprising Coolia malayensis, C. palmyrensis, C. tropicalis, and the C. cf. canariensis lineage. This is the first report of Coolia palmyrensis and C. cf. canariensis in Mexico and C. tropicalis in the Gulf of California. Our results strengthen the biogeographical understanding of these potentially harmful epiphytic dinoflagellate species.

• Mycobiology
• /
• v.40 no.2
• /
• pp.94-99
• /
• 2012

During an investigation of fungi from an elm tree infested with bark beetles in Korea, one isolate, DUCC401, was isolated from elm wood. Based on morphological characteristics and phylogenetic analysis of the internal transcribed spacer and 28S rDNA (large subunit) sequences, the isolate, DUCC401, was identified as Mariannaea samuelsii. Mycelia of the fungus grew faster on malt extract agar than on potato dextrose agar and oatmeal agar media. Temperature and pH for optimal growth of fungal mycelia were 25oC and pH 7.0, respectively. The fungus demonstrated the capacity to degrade cellobiose, starch, and xylan. This is the first report on isolation of Mariannaea samuelsii in Korea.

• Korean Journal of Environmental Biology
• /
• v.37 no.3
• /
• pp.362-366
• /
• 2019

A marine green algal species (Chlorophyta) was collected from the eastern coast of Korea. It is morphologically characterized by monostromatic thallus, usually undulate and entire margins, cap-like chloroplast and several pyrenoids per cell. In a phylogenetic tree based on molecular data, the Korean alga nests in the same clade as Monostroma alittorale originally described from Japan, as a sister clade of M. grevillei from France. The genetic distance for ITS(Internal Transcribed Spacer) sequences among Monostroma species ranges from 2.3% to 38.2%. The value between the Korean entity and M. alittorale was calculated as 0.01%, considered to be intraspecific divergence. This Korean entity is identified as Monostroma alittorale based on morphological and molecular analyses. This is the first record of M. alittorale in Korea.

• Journal of Microbiology and Biotechnology
• /
• v.26 no.4
• /
• pp.675-683
• /
• 2016

One osmotolerant strain from among 44 yeast isolates was selected based on its growth abilities in media containing high concentrations of sucrose. This selected strain, named SK-ENNY, was identified as Meyerozyma guilliermondii by sequencing the internal transcribed spacer regions and partial D1/D2 large-subunit domains of the 26S ribosomal RNA. SK-ENNY was utilized to produce high-fructose glucose syrup (HFGS) from sucrose-containing biomass. Conversion rates to HFGS from 310-610 g/l of pure sucrose and from 75-310 g/l of sugar beet molasses were 73.5-94.1% and 76.2-91.1%, respectively. In the syrups produced, fructose yields were 89.4-100% and 96.5-100% and glucose yields were 57.6-82.5% and 55.3-79.5% of the theoretical values for pure sucrose and molasses sugars, respectively. This is the first report of employing M. guilliermondii for production of HFGS from sucrose-containing biomass.

• The Korean Journal of Mycology
• /
• v.45 no.4
• /
• pp.304-318
• /
• 2017

While evaluating fungal diversity in fecal and freshwater samples in Korea, three fungal strains, CNUFC-GHD83-1, CNUFC-RD8126, and CNUFC-YR2-1, were isolated from specific habitats including grasshopper and rat feces, and freshwater samples in Korea. On the basis of the morphological characteristics and phylogenetic analysis of the internal transcribed spacer (ITS) and 28S rDNA, the isolates CNUFC-GHD83-1, CNUFC-RD8126, and CNUFC-YR2-1 were identified as Albifimbria terrestris, Cephaliophora tropica, and Mariannaea aquaticola, respectively. These species have not been previously described in Korea.

• The Korean Journal of Mycology
• /
• v.43 no.2
• /
• pp.125-128
• /
• 2015

Mattirolomyces terfezioides and Tricholoma bakamatsutake, commercially important mycorrhizal mushrooms, were found for the first time in the forests of Robinia pseudoacacia and Quercus mongolica of the Korean peninsula, respectively. Morphological and molecular characteristics were discussed in the paper. We have also given the Korean name to the fungi here.