• Research in Plant Disease
• /
• v.17 no.2
• /
• pp.169-176
• /
• 2011

Phytophthora katsurae is the fungus responsible for chestnut ink disease. The objectives of this study were to determine if a single-strand conformation polymorphism (SSCP) analysis of rDNA-ITS region, elongation factor 1 alpha gene and ${\beta}$-tubulin gene could be used for rapid identification and genetic diversity of P. katsurae, and to assess the potential use of the SSCP technique as a diagnostic tool for P. katsurae. Each regions amplified by PCR using primers designed to overlap the genus Phytophthora were characterized for the Phytophthora species. PCR products were denatured and electrophoresed for SSCP analysis. P. katsurae isolates showed an unique pattern in SSCP analysis and were easily distinguished from other Phytophthora species used as the control. This indicates that SSCP analysis is an useful technique for distinguishing Phytophthora species from genetically close relatives, and show that the SSCP analysis of each region is an efficient detection tool for P. katsurae. But PCR-SSCP analysis of single-gene may have difficulty in distinguishing P. katsurae from other Phytophthora species. Therefore, PCR-SSCP analysis of multi-genes can be useful for rapid and effective identification of P. katsurae.

• Journal of Microbiology and Biotechnology
• /
• v.25 no.1
• /
• pp.98-108
• /
• 2015

Staphylococcus aureus is an important foodborne pathogen that causes diverse diseases ranging from minor infections to life-threatening conditions in humans and animals. To further understand its pathogenesis, the genome of the strain S. aureus FORC_001 was isolated from a contaminated food. Its genome consists of 2,886,017 bp double-stranded DNA with a GC content of 32.8%. It is predicted to contain 2,728 open reading frames, 57 tRNAs, and 6 rRNA operons, including 1 additional 5S rRNA gene. Comparative phylogenetic tree analysis of 40 complete S. aureus genome sequences using average nucleotide identity (ANI) revealed that strain FORC_001 belonged to Group I. The closest phylogenetic match was S. aureus MRSA252, according to a whole-genome ANI (99.87%), suggesting that they might share a common ancestor. Comparative genome analysis of FORC_001 and MRSA252 revealed two non-homologous regions: Regions I and II. The presence of various antibiotic resistance genes, including the SCCmec cluster in Region I of MRSA252, suggests that this strain might have acquired the SCCmec cluster to adapt to specific environments containing methicillin. Region II of both genomes contains prophage regions but their DNA sequence identity is very low, suggesting that the prophages might differ. This is the first report of the complete genome sequence of S. aureus isolated from a real foodborne outbreak in South Korea. This report would be helpful to extend our understanding about the genome, general characteristics, and virulence factors of S. aureus for further studies of pathogenesis, rapid detection, and epidemiological investigation in foodborne outbreak.

• Applied Biological Chemistry
• /
• v.50 no.2
• /
• pp.101-106
• /
• 2007

Twenty-two strains of nematophagous fungi were isolated from 100 soil samples. Nematophagous fungi were classified into three categories; 3-dimensional adhesive nets (A group), 2-dimensional adhesive nets (B group) and constricting ring (C group). Nine strains were selected and identified on the basis of morphological characteristics (hypha, conidiophore, form and size of conidia, number of conidia, node of conidophore, number and location of septa, size and color of chlamydospore) and ITS (internal transcribed spacer) region of rDNA sequences. As the results, the isolated were identified as belonging to the species of Monacrosporium thaumasium (Kan-2, Kan-4, Kan-11), Arthrobotrys oligospora (Kan-9, Kan-13, Kan-20, Kan-21), A. musiformis (Kan-12), and A. dactyloides (Kan-22).

• Journal of Korean Society of Forest Science
• /
• v.99 no.2
• /
• pp.172-178
• /
• 2010

The status of ectomycorrhizal (ECM) fungal colonization in Pinus thunbergii seedlings was investigated 2 years after planting in an eastern coastal area of Korea. We established three $10{\times}10$ m plots at a P. thunbergii plantation in Gangneung and sampled lateral roots from 10 seedlings in each plot. ECMs were classified into morphological groups and the number of root tips of each morphotype was counted. In total, 8 ECM morphotypes were observed and fungal species that form each morphotype were identified by sequencing of the internal transcribed spacer (ITS) region of the nuclear rDNA. Suillus granulatus was the most abundant species (44.1-65.7% of relative abundance) in all plots, followed by Tomentella ellisii (14.0-37.8%) and unidentified fungus belonged to Atheliaceae (10.6-20.1%). These 3 fungal species accounted for almost all of the ECM abundance in each plot (94.9-99.8%). The remaining 5 fungal species were uncommon and rare. There was no clear difference in ECM fungal communities among plots. Community structure of ECM fungi in the young P. thunbergii plantation was simple and composed of fungal species that were also observed in mature coastal pine forests.

• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• The Korean Journal of Mycology
• /
• v.37 no.2
• /
• pp.134-138
• /
• 2009

This study was conducted to investigate colonization of ectomycorrhizal fungi(ECM) in roots of Abies koreana which is an endemic and endangered species in Korea. Roots of A. koreana were collected at Mt. Halla. ECM root tips were classified using morphotyping and identified using sequences of internal transcribed spacer (ITS) region of the fungal rDNA. Total 8 species of ECM fungi were identified from roots of 11 seedlings of A. koreana : Cenococum geophilum, Russula brevipes, 2 species of Russula, 2 species of Thelephora, Cortinarius camphorates and 2 species of Helotiales. These species were known to be typical ectomycorrhizal fungi found in coniferous mature forests.

• International Journal of Industrial Entomology and Biomaterials
• /
• v.44 no.2
• /
• pp.55-64
• /
• 2022

Bombyx shini Park & Sohn, 2002 (Lepidoptera: Bombycidae), which was listed as an endemic species in South Korea has recently been renamed as the East Asian silk moth Rotunda rotundapex Miyata & Kishida, 1990 (Lepidoptera: Bombycidae). In this study, we sequenced the complete mitochondrial genome (mitogenome) of the R. rotundapex to announce genomic characteristics and to clarify its validity with a new name. The 15,294-bp long complete mitogenome comprises a typical set of genes [13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes] and one major noncoding, A + T-rich region, with an arrangement identical to that observed in most lepidopteran mitogenomes. The A/T content of the whole mitogenome was 79.22%; however, it varied among the regions/genes as follows: A + T-rich region, 91.62%; srRNA, 84.67%; lrRNA, 83.01%; tRNAs, 81.43%; and PCGs, 77.46%. Phylogenetic analyses of 35 species in the Bombycoidea superfamily showed the sister relationship between the families Sphingidae and Bombycidae s. str., with the higher nodal support [bootstrap support (BS) = 78%]. The Saturniidae was placed as the sister to the two families, but the nodal support for this relationship was low (BS = 53%). Current R. rotundapex was placed together with previously reported con-species with the highest nodal support, forming a separate clade from Bombyx, validating that B. shini can have a new genus name, Rotunda. However, the Korean R. rotundapex showed a substantial sequence divergence at 5.28% to that originated from an individual of type locality Taiwan in 1,459-bp of COI sequences. Considering such a high sequence divergence an additional study, which includes morphological and DNA barcoding data from further extensive distributional range maybe is needed for further robust taxonomic conclusion.

• The Plant Pathology Journal
• /
• v.33 no.2
• /
• pp.184-192
• /
• 2017

Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1) of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at $63^{\circ}C$ for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was $10^{-2}J2/0.5g$ of soil, which was 10 times more sensitive than conventional PCR ($10^{-1}J2/0.5g$ of soil). Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.

• The Korean Journal of Mycology
• /
• v.44 no.4
• /
• pp.350-354
• /
• 2016

Diverse wild yeast were isolated from freshwaters and soils of Nakdong and Yeongsan rivers in Korea and identified by the comparison of polymerase chain reaction-amplified nucleotide sequences of the internal transcribed spacer region (including the 5.8S rRNA) and D1/D2 regions of 26S rDNA, using BLAST. In total, 15 strains belonging to 9 species were isolated from 25 samples, out of which Aureobasidium pullulans and Cryptococcus bestiolae were dominant. Candida ghanaensis JSF0127 and Meira geulakonigii JSF0130 were identified as unrecorded yeasts, for which their mycological characteristics were investigated. These unrecorded yeasts formed ascospores and grew in yeast extract peptone dextrose medium containing 5% NaCl.

• BMB Reports
• /
• v.32 no.5
• /
• pp.486-491
• /
• 1999

An engineered cDNA from Phanerochaete chrysosporium encoding both the mature and propeptide-sequence regions of lignin peroxidase H2 (Lip H2) was overexpressed in Escherichia coli BL21 (DE3) to evaluate its catalytic characteristics and potential application as a pollution scavenger. All expressed proteins were aggregated in an inactive inclusion body, which might be due to inherent disulfide bonds. Active enzyme was obtained by refolding with glutathione-mediated oxidation in refolding solution containing $Ca^{2+}$, heme, and urea. Propeptide-sequence region was not processed as evidenced by N-terminal sequence analysis. Recombinant Lip H2 (rLip H2) had the same physical properties of the native protein but differed in the $K_{cat}$. Catalytic efficiency ($k_{cat}/K_m$) of rLip H2 was slightly higher than that of the native enzyme. In order to express an active protein, fusion systems with thioredoxin or Dsb A, which have disulfide isomerase activity, were used. The fused proteins expressed by the Dsb A fusion vector were aggregated, whereas half of the thioredoxin fusion proteins were recovered as a soluble form but still catalytically inactive. These results suggest that Lip H2 may not be expressed as an active enzyme in Escherichia coli although the activity can be recovered by in vitro refolding.