Phytophthora katsurae is the fungus responsible for chestnut ink disease. The objectives of this study were to determine if a single-strand conformation polymorphism (SSCP) analysis of rDNA-ITS region, elongation factor 1 alpha gene and ${\beta}$-tubulin gene could be used for rapid identification and genetic diversity of P. katsurae, and to assess the potential use of the SSCP technique as a diagnostic tool for P. katsurae. Each regions amplified by PCR using primers designed to overlap the genus Phytophthora were characterized for the Phytophthora species. PCR products were denatured and electrophoresed for SSCP analysis. P. katsurae isolates showed an unique pattern in SSCP analysis and were easily distinguished from other Phytophthora species used as the control. This indicates that SSCP analysis is an useful technique for distinguishing Phytophthora species from genetically close relatives, and show that the SSCP analysis of each region is an efficient detection tool for P. katsurae. But PCR-SSCP analysis of single-gene may have difficulty in distinguishing P. katsurae from other Phytophthora species. Therefore, PCR-SSCP analysis of multi-genes can be useful for rapid and effective identification of P. katsurae.
Staphylococcus aureus is an important foodborne pathogen that causes diverse diseases ranging from minor infections to life-threatening conditions in humans and animals. To further understand its pathogenesis, the genome of the strain S. aureus FORC_001 was isolated from a contaminated food. Its genome consists of 2,886,017 bp double-stranded DNA with a GC content of 32.8%. It is predicted to contain 2,728 open reading frames, 57 tRNAs, and 6 rRNA operons, including 1 additional 5S rRNA gene. Comparative phylogenetic tree analysis of 40 complete S. aureus genome sequences using average nucleotide identity (ANI) revealed that strain FORC_001 belonged to Group I. The closest phylogenetic match was S. aureus MRSA252, according to a whole-genome ANI (99.87%), suggesting that they might share a common ancestor. Comparative genome analysis of FORC_001 and MRSA252 revealed two non-homologous regions: Regions I and II. The presence of various antibiotic resistance genes, including the SCCmec cluster in Region I of MRSA252, suggests that this strain might have acquired the SCCmec cluster to adapt to specific environments containing methicillin. Region II of both genomes contains prophage regions but their DNA sequence identity is very low, suggesting that the prophages might differ. This is the first report of the complete genome sequence of S. aureus isolated from a real foodborne outbreak in South Korea. This report would be helpful to extend our understanding about the genome, general characteristics, and virulence factors of S. aureus for further studies of pathogenesis, rapid detection, and epidemiological investigation in foodborne outbreak.
Twenty-two strains of nematophagous fungi were isolated from 100 soil samples. Nematophagous fungi were classified into three categories; 3-dimensional adhesive nets (A group), 2-dimensional adhesive nets (B group) and constricting ring (C group). Nine strains were selected and identified on the basis of morphological characteristics (hypha, conidiophore, form and size of conidia, number of conidia, node of conidophore, number and location of septa, size and color of chlamydospore) and ITS (internal transcribed spacer) region of rDNA sequences. As the results, the isolated were identified as belonging to the species of Monacrosporium thaumasium (Kan-2, Kan-4, Kan-11), Arthrobotrys oligospora (Kan-9, Kan-13, Kan-20, Kan-21), A. musiformis (Kan-12), and A. dactyloides (Kan-22).
The status of ectomycorrhizal (ECM) fungal colonization in Pinus thunbergii seedlings was investigated 2 years after planting in an eastern coastal area of Korea. We established three $10{\times}10$ m plots at a P. thunbergii plantation in Gangneung and sampled lateral roots from 10 seedlings in each plot. ECMs were classified into morphological groups and the number of root tips of each morphotype was counted. In total, 8 ECM morphotypes were observed and fungal species that form each morphotype were identified by sequencing of the internal transcribed spacer (ITS) region of the nuclear rDNA. Suillus granulatus was the most abundant species (44.1-65.7% of relative abundance) in all plots, followed by Tomentella ellisii (14.0-37.8%) and unidentified fungus belonged to Atheliaceae (10.6-20.1%). These 3 fungal species accounted for almost all of the ECM abundance in each plot (94.9-99.8%). The remaining 5 fungal species were uncommon and rare. There was no clear difference in ECM fungal communities among plots. Community structure of ECM fungi in the young P. thunbergii plantation was simple and composed of fungal species that were also observed in mature coastal pine forests.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
This study was conducted to investigate colonization of ectomycorrhizal fungi(ECM) in roots of Abies koreana which is an endemic and endangered species in Korea. Roots of A. koreana were collected at Mt. Halla. ECM root tips were classified using morphotyping and identified using sequences of internal transcribed spacer (ITS) region of the fungal rDNA. Total 8 species of ECM fungi were identified from roots of 11 seedlings of A. koreana : Cenococum geophilum, Russula brevipes, 2 species of Russula, 2 species of Thelephora, Cortinarius camphorates and 2 species of Helotiales. These species were known to be typical ectomycorrhizal fungi found in coniferous mature forests.
International Journal of Industrial Entomology and Biomaterials
/
v.44
no.2
/
pp.55-64
/
2022
Bombyx shini Park & Sohn, 2002 (Lepidoptera: Bombycidae), which was listed as an endemic species in South Korea has recently been renamed as the East Asian silk moth Rotunda rotundapex Miyata & Kishida, 1990 (Lepidoptera: Bombycidae). In this study, we sequenced the complete mitochondrial genome (mitogenome) of the R. rotundapex to announce genomic characteristics and to clarify its validity with a new name. The 15,294-bp long complete mitogenome comprises a typical set of genes [13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes] and one major noncoding, A + T-rich region, with an arrangement identical to that observed in most lepidopteran mitogenomes. The A/T content of the whole mitogenome was 79.22%; however, it varied among the regions/genes as follows: A + T-rich region, 91.62%; srRNA, 84.67%; lrRNA, 83.01%; tRNAs, 81.43%; and PCGs, 77.46%. Phylogenetic analyses of 35 species in the Bombycoidea superfamily showed the sister relationship between the families Sphingidae and Bombycidae s. str., with the higher nodal support [bootstrap support (BS) = 78%]. The Saturniidae was placed as the sister to the two families, but the nodal support for this relationship was low (BS = 53%). Current R. rotundapex was placed together with previously reported con-species with the highest nodal support, forming a separate clade from Bombyx, validating that B. shini can have a new genus name, Rotunda. However, the Korean R. rotundapex showed a substantial sequence divergence at 5.28% to that originated from an individual of type locality Taiwan in 1,459-bp of COI sequences. Considering such a high sequence divergence an additional study, which includes morphological and DNA barcoding data from further extensive distributional range maybe is needed for further robust taxonomic conclusion.
Tylenchulus semipenetrans is an important and widespread plant-parasitic nematode of citrus worldwide and can cause citrus slow decline disease leading to significant reduction in tree growth and yield. Rapid and accurate detection of T. semipenetrans in soil is important for the disease forecasting and management. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed to detect T. semipenetrans using DNA extracted from soil. A set of five primers was designed from the internal transcribed spacer region (ITS1) of rDNA, and was highly specific to T. semipenetrans. The LAMP reaction was performed at $63^{\circ}C$ for 60 min. The LAMP product was visualized directly in one reaction tube by adding SYBR Green I. The detection limit of the LAMP assay was $10^{-2}J2/0.5g$ of soil, which was 10 times more sensitive than conventional PCR ($10^{-1}J2/0.5g$ of soil). Examination of 24 field soil samples revealed that the LAMP assay was applicable to a range of soils infested naturally with T. semipenetrans, and the total assay time was less than 2.5 h. These results indicated that the developed LAMP assay is a simple, rapid, sensitive, specific and accurate technique for detection of T. semipenetrans in field soil, and contributes to the effective management of citrus slow decline disease.
Diverse wild yeast were isolated from freshwaters and soils of Nakdong and Yeongsan rivers in Korea and identified by the comparison of polymerase chain reaction-amplified nucleotide sequences of the internal transcribed spacer region (including the 5.8S rRNA) and D1/D2 regions of 26S rDNA, using BLAST. In total, 15 strains belonging to 9 species were isolated from 25 samples, out of which Aureobasidium pullulans and Cryptococcus bestiolae were dominant. Candida ghanaensis JSF0127 and Meira geulakonigii JSF0130 were identified as unrecorded yeasts, for which their mycological characteristics were investigated. These unrecorded yeasts formed ascospores and grew in yeast extract peptone dextrose medium containing 5% NaCl.
An engineered cDNA from Phanerochaete chrysosporium encoding both the mature and propeptide-sequence regions of lignin peroxidase H2 (Lip H2) was overexpressed in Escherichia coli BL21 (DE3) to evaluate its catalytic characteristics and potential application as a pollution scavenger. All expressed proteins were aggregated in an inactive inclusion body, which might be due to inherent disulfide bonds. Active enzyme was obtained by refolding with glutathione-mediated oxidation in refolding solution containing $Ca^{2+}$, heme, and urea. Propeptide-sequence region was not processed as evidenced by N-terminal sequence analysis. Recombinant Lip H2 (rLip H2) had the same physical properties of the native protein but differed in the $K_{cat}$. Catalytic efficiency ($k_{cat}/K_m$) of rLip H2 was slightly higher than that of the native enzyme. In order to express an active protein, fusion systems with thioredoxin or Dsb A, which have disulfide isomerase activity, were used. The fused proteins expressed by the Dsb A fusion vector were aggregated, whereas half of the thioredoxin fusion proteins were recovered as a soluble form but still catalytically inactive. These results suggest that Lip H2 may not be expressed as an active enzyme in Escherichia coli although the activity can be recovered by in vitro refolding.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.