• Journal of Microbiology
• /
• v.39 no.1
• /
• pp.56-61
• /
• 2001

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

• The Korean Journal of Mycology
• /
• v.45 no.3
• /
• pp.224-228
• /
• 2017

The fungal strain, designated KNU16-008, was isolated from field soil in Chungcheongnam-do, Korea. The isolated fungi was characterized by morphological and phylogenetic analyses. Isolated fungus showed typical morphological characteristics of the genus Sporothrix. Based on its phylogenic analysis using internal transcribed spacer (ITS) of rDNA and ${\beta}$-tubulin gene sequences, the strain KNU16-008 was identified as Sporothrix stylites. This species has not been previously reported in Korea.

• The Korean Journal of Mycology
• /
• v.44 no.4
• /
• pp.355-359
• /
• 2016

During a survey of fungal diversity in insect guts in Korea, two fungal strains, EML-PGH2 and EML-PUKI88, were isolated from the gut of grasshopper and soldier fly larvae inhabiting the bulrush plants at a pond located in the Chonnam National University Arboretum, Gwangju, Korea. Based on their morphological characteristics and a phylogenetic analysis of the internal transcribed spacer (ITS1 and ITS2) and 5.8S rDNA sequences, the strains were identified as Blakeslea trispora. To our knowledge, the zygomycete species B. trispora has not been previously described in Korea.

• Mycobiology
• /
• v.42 no.4
• /
• pp.409-411
• /
• 2014

In March 2014, a kohlrabi stem rot sample was collected from the cold storage room of Daegwallyong Horticultural Cooperative, Korea. White and fuzzy mycelial growth was observed on the stem, symptomatic of stem rot disease. The pathogen was isolated from the infected stem and cultured on potato dextrose agar for further fungal morphological observation and to confirm its pathogenicity, according to Koch's postulates. Morphological data, pathogenicity test results, and rDNA sequences of internal transcribed spacer regions (ITS 1 and 4) showed that the postharvest stem rot of kohlrabi was caused by Sclerotinia sclerotiorum. This is the first report of postharvest stem rot of kohlrabi in Korea.

• The Korean Journal of Mycology
• /
• v.41 no.1
• /
• pp.47-51
• /
• 2013

Yeasts isolated from wild flowers of Gyejoksan in Daejeon city, Oseosan in Chungchungnamdo, and Baekamsan in Jeollabukdo, Korea were identified by comparison of nucleotide sequences for PCR-amplified D1/D2 region of 26S rDNA or internal transcribed spacer (ITS) 1 and 2 including 5.8S rDNA using BLAST. Twelve yeast strains of ten species and seventeen yeast strains of ten species were isolated from wild flowers of Gyejoksan and Oseosan, respectively. And thirty seven yeast strains of twenty four species were isolated from wild flowers of Baekamsan. Total thirty four yeast species were isolated from three different sample collection areas, but only nine species were overlapped from the at least two different sampling areas: Cryptococcus sp., Cryptococcus aureus, Cryptococcus flavescens, Cryptococcus flavus, Metschnikowia sp., Pseudozyma aphidis, Rhodotorula glutinis, Sporobolomyces carnicolor, and Sporobolomyces ruberrimus. Among them only Cryptococcus aureus was occurred from all three different collection sites. Other twenty five species were restricted to specific collection site suggesting that each area has distinctive yeast flora.

• Korean Journal of Ichthyology
• /
• v.22 no.3
• /
• pp.201-205
• /
• 2010

One specimen of a natural hybrid of an Oplegnathus (Oplegnathus fasciatus $\times$ Oplegnathus punctatus) was found in Tongyeong, Korea in August 2008. We, herein, describe its morphological and genetic characteristics and compare them with those of O. fasciatus and O. punctatus. In morphology, the hybrid showed many distinctive black rounded blotches on body sides and four faint vertical bars, being in those features similar to O. punctatus. Although the counts and measurements of the hybrid mostly overlapped between O. fasciatus and O. punctatus, the Oplegnathus hybrid resembled O. punctatus in the ratio of pelvic-fin length in standard length: Oplegnathus hybrid (26.7%) was closer to O. punctatus (26.4%) than to O. fasciatus (17.2~23.6%). In genetics, as a result of analysis of 510 base pair sequences of mitochondrial DNA 16S rRNA, the hybrid was closer to O. fasciatus (d=0.000~0.010) than to O. punctatus (d=0.020). Our results suggest that the natural hybridization represented by the subject specimen occurred between an O. fasciatus female and an O. punctatus male.

• Korean Journal of Microbiology
• /
• v.37 no.2
• /
• pp.114-119
• /
• 2001

Many isolates from different forest soil layers did not show appreciable growth on full strength of the conventional nutrient broth (NB medium) but grow on its 100-fold dilution (DNB medium). These isolates were divided into four types according to organic nutrient concentration in the growth medium from $1^{-1}\;to\;10^{-4}$dilution of normal NB medium. Oligotrophic bacteria were type II and type IV which grew in $10^{-4}$ dilution of NB (1 mg C/l) medium. Sixty strains were isolated for obligate oligotrophic bacteria. Chemotaxonomic and phylogenetic characteristics of eleven isolates of acetylene-reducing (nitrogen-fixing) oligotrophic bacteria from forest soil were investigated. They showed similar characteristics: the cellular fatty acid mainly consisted of straight-chain unsaturated $C_{18:1}$ (60-84% of total fatty acids). Ubiquinone Q-10 and a high guanine plus-cytosine content(61-64 mol%) were found. Eleven isolates of nitrogen-fixing oligotrophic bacteria were found to be closely related by full 16S rDNA sequence simility and many common taxonomic traits. Analysis of full 16S rDNA sequences of eleven isolates indicated that they were more closely related to Bradyrhizobium (similarity values: 98.1-98.8%), Agromonas, Nitrobacter, and Afipia.

• Food Science and Biotechnology
• /
• v.16 no.1
• /
• pp.133-137
• /
• 2007

The Strain TFM-7, Which has an antitumor effect, was isolated from Kefir and identified based on analysis using the API 50 CHL kit and 265 rDNA sequencing. Strain TFM-7 was confirmed to belong to the genus Kluyveromyces. Analysis of the 265 rDNA nucleotide sequences found strain TFM-7 to be related to Kluyveromyces marxianus. NRRL Y-828IT. K. marxianus. TFM-7 was cultured with potato dektrose broth medium at $27^{\circ}C$ for 72 hr, and its inhibition effects on the proliferation of seven tumor cell lines and a normal cell line were assessed using the MTT assay. The antitumor effects and growth characteristics of K. marxianus TFM-7 were investigated during a culture period of 7 days. By the $3^{rd}\;day$, K. marxianus TFM-7 showed a dry cell weight 2.39 g/L, a pH of 4.39, an ethanol content of 0.89%, and an inhibition effect on the proliferation of seven tumor cell lines above 50%, except for A-549 tumor cell line. K. marxianus TFM-7 was the most effective at inhibiting the growth of Hep-2 cell line among all tumor cell lines tested. Growth inhibition of a normal cell line, NIH/3T3, was less than 35%, suggesting a decreased level of cytotoxicity toward normal cells. These results indicate that K. marxianus TFM-7 may have used as a yeast strain with antitumor activity.

• Journal of Microbiology and Biotechnology
• /
• v.20 no.10
• /
• pp.1386-1392
• /
• 2010

A bacterial strain designated GR5$^T$, previously isolated from a freshwater culture pond in Taiwan while screening for bacteria for antimicrobial compounds, was characterized using a polyphasic taxonomic approach. Strain GR5$^T$ was found to be Gram-negative, aerobic, greenish-yellow colored, rod-shaped, and motile by means of a single polar flagellum. Growth occurred at $10-40^{\circ}C$ (optimum, $35^{\circ}C$), pH 7.0-8.0 (optimum pH 8.0), and with 0-2.0% NaCl (optimum, 0.5-1.0%). The major fatty acids were $C_{16:1}{\omega}7c$(36.3%), $C_{16:0}$(16.6%), $C_{12:0}$ 3-OH (12.5%), and $C_{18:1}{\omega}7c$(9.1%). The major respiratory quinone was Q-8, and the DNA G+C content of the genomic DNA was 51.9 mol%. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain GR5$^T$ belongs to the genus Rheinheimera, where its most closely related neighbors are Rheinheimera texasensis A62-14B$^T$ and Rheinheimera tangshanensis JA3-B52$^T$ with sequence similarities of 98.1% and 97.5%, respectively, and the sequence similarities to any other recognized species within Gammaproteobacteria are less than 96.5%. The mean level of DNA-DNA relatedness between strain GR5$^T$ and R. texasensis A62-14B$^T$, the strain most closely related to the isolate, was $26.5{\pm}7.6%$. Therefore, based on the phylogenetic and phenotypic data, strain GR5$^T$ should be classified as a novel species, for which the name Rheinheimera aquatica sp. nov. is proposed. The type strain is GR5$^T$ (=BCRC 80081$^T$=LMG 25379$^T$).

• Research in Plant Disease
• /
• v.29 no.4
• /
• pp.420-424
• /
• 2023

In 2020, within the Dongbaekdongsan area in Jeju Island, a Septobasidium sp. associated with a felt disease in Castanopsis sieboldii (Makino) Hatus. ex T. Yamaz. & Mashiba was identified. The symptom included the presence of brown, thin, and silk-like mycelial mats attached to the tree's bark, displaying variations in size from large to small. To induce hyphal growth, the samples collected were incubated in a moist chamber, and the newly formed hyphae were subjected to genomic DNA extractions. The nucleotide sequences of the internal transcribed spacer and small subunit rDNA genes were determined, and molecular characteristics among the isolates were investigated through polymerase chain reaction-based restriction fragment length polymorphism analysis. This Septobasidium sp. exhibited distinct morphological and phylogenetic features compared to those that were previously reported in South Korea. Consequently, this strain is taxonomically classified as a provisionally novel species of Septobasidium. Furthermore, the observed felt disease exhibited a high degree of host specificity, as it was exclusively identified in C. sieboldii without occurrence in other tree species at the time of observation.