Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Park, Sangkyu;Lee, Seung-Yeol;Back, Chang-Gi;Kang, In-Kyu;Ten, Leonid;Lee, Hyang Burm;Jung, Hee-Young
The Korean Journal of Mycology
/
v.45
no.3
/
pp.224-228
/
2017
The fungal strain, designated KNU16-008, was isolated from field soil in Chungcheongnam-do, Korea. The isolated fungi was characterized by morphological and phylogenetic analyses. Isolated fungus showed typical morphological characteristics of the genus Sporothrix. Based on its phylogenic analysis using internal transcribed spacer (ITS) of rDNA and ${\beta}$-tubulin gene sequences, the strain KNU16-008 was identified as Sporothrix stylites. This species has not been previously reported in Korea.
During a survey of fungal diversity in insect guts in Korea, two fungal strains, EML-PGH2 and EML-PUKI88, were isolated from the gut of grasshopper and soldier fly larvae inhabiting the bulrush plants at a pond located in the Chonnam National University Arboretum, Gwangju, Korea. Based on their morphological characteristics and a phylogenetic analysis of the internal transcribed spacer (ITS1 and ITS2) and 5.8S rDNA sequences, the strains were identified as Blakeslea trispora. To our knowledge, the zygomycete species B. trispora has not been previously described in Korea.
Kim, Joon-Young;Aktaruzzaman, Md.;Afroz, Tania;Hahm, Young-Il;Kim, Byung-Sup
Mycobiology
/
v.42
no.4
/
pp.409-411
/
2014
In March 2014, a kohlrabi stem rot sample was collected from the cold storage room of Daegwallyong Horticultural Cooperative, Korea. White and fuzzy mycelial growth was observed on the stem, symptomatic of stem rot disease. The pathogen was isolated from the infected stem and cultured on potato dextrose agar for further fungal morphological observation and to confirm its pathogenicity, according to Koch's postulates. Morphological data, pathogenicity test results, and rDNA sequences of internal transcribed spacer regions (ITS 1 and 4) showed that the postharvest stem rot of kohlrabi was caused by Sclerotinia sclerotiorum. This is the first report of postharvest stem rot of kohlrabi in Korea.
Yeasts isolated from wild flowers of Gyejoksan in Daejeon city, Oseosan in Chungchungnamdo, and Baekamsan in Jeollabukdo, Korea were identified by comparison of nucleotide sequences for PCR-amplified D1/D2 region of 26S rDNA or internal transcribed spacer (ITS) 1 and 2 including 5.8S rDNA using BLAST. Twelve yeast strains of ten species and seventeen yeast strains of ten species were isolated from wild flowers of Gyejoksan and Oseosan, respectively. And thirty seven yeast strains of twenty four species were isolated from wild flowers of Baekamsan. Total thirty four yeast species were isolated from three different sample collection areas, but only nine species were overlapped from the at least two different sampling areas: Cryptococcus sp., Cryptococcus aureus, Cryptococcus flavescens, Cryptococcus flavus, Metschnikowia sp., Pseudozyma aphidis, Rhodotorula glutinis, Sporobolomyces carnicolor, and Sporobolomyces ruberrimus. Among them only Cryptococcus aureus was occurred from all three different collection sites. Other twenty five species were restricted to specific collection site suggesting that each area has distinctive yeast flora.
One specimen of a natural hybrid of an Oplegnathus (Oplegnathus fasciatus $\times$ Oplegnathus punctatus) was found in Tongyeong, Korea in August 2008. We, herein, describe its morphological and genetic characteristics and compare them with those of O. fasciatus and O. punctatus. In morphology, the hybrid showed many distinctive black rounded blotches on body sides and four faint vertical bars, being in those features similar to O. punctatus. Although the counts and measurements of the hybrid mostly overlapped between O. fasciatus and O. punctatus, the Oplegnathus hybrid resembled O. punctatus in the ratio of pelvic-fin length in standard length: Oplegnathus hybrid (26.7%) was closer to O. punctatus (26.4%) than to O. fasciatus (17.2~23.6%). In genetics, as a result of analysis of 510 base pair sequences of mitochondrial DNA 16S rRNA, the hybrid was closer to O. fasciatus (d=0.000~0.010) than to O. punctatus (d=0.020). Our results suggest that the natural hybridization represented by the subject specimen occurred between an O. fasciatus female and an O. punctatus male.
Many isolates from different forest soil layers did not show appreciable growth on full strength of the conventional nutrient broth (NB medium) but grow on its 100-fold dilution (DNB medium). These isolates were divided into four types according to organic nutrient concentration in the growth medium from $1^{-1}\;to\;10^{-4}$dilution of normal NB medium. Oligotrophic bacteria were type II and type IV which grew in $10^{-4}$ dilution of NB (1 mg C/l) medium. Sixty strains were isolated for obligate oligotrophic bacteria. Chemotaxonomic and phylogenetic characteristics of eleven isolates of acetylene-reducing (nitrogen-fixing) oligotrophic bacteria from forest soil were investigated. They showed similar characteristics: the cellular fatty acid mainly consisted of straight-chain unsaturated $C_{18:1}$ (60-84% of total fatty acids). Ubiquinone Q-10 and a high guanine plus-cytosine content(61-64 mol%) were found. Eleven isolates of nitrogen-fixing oligotrophic bacteria were found to be closely related by full 16S rDNA sequence simility and many common taxonomic traits. Analysis of full 16S rDNA sequences of eleven isolates indicated that they were more closely related to Bradyrhizobium (similarity values: 98.1-98.8%), Agromonas, Nitrobacter, and Afipia.
The Strain TFM-7, Which has an antitumor effect, was isolated from Kefir and identified based on analysis using the API 50 CHL kit and 265 rDNA sequencing. Strain TFM-7 was confirmed to belong to the genus Kluyveromyces. Analysis of the 265 rDNA nucleotide sequences found strain TFM-7 to be related to Kluyveromyces marxianus. NRRL Y-828IT. K. marxianus. TFM-7 was cultured with potato dektrose broth medium at $27^{\circ}C$ for 72 hr, and its inhibition effects on the proliferation of seven tumor cell lines and a normal cell line were assessed using the MTT assay. The antitumor effects and growth characteristics of K. marxianus TFM-7 were investigated during a culture period of 7 days. By the $3^{rd}\;day$, K. marxianus TFM-7 showed a dry cell weight 2.39 g/L, a pH of 4.39, an ethanol content of 0.89%, and an inhibition effect on the proliferation of seven tumor cell lines above 50%, except for A-549 tumor cell line. K. marxianus TFM-7 was the most effective at inhibiting the growth of Hep-2 cell line among all tumor cell lines tested. Growth inhibition of a normal cell line, NIH/3T3, was less than 35%, suggesting a decreased level of cytotoxicity toward normal cells. These results indicate that K. marxianus TFM-7 may have used as a yeast strain with antitumor activity.
A bacterial strain designated GR5$^T$, previously isolated from a freshwater culture pond in Taiwan while screening for bacteria for antimicrobial compounds, was characterized using a polyphasic taxonomic approach. Strain GR5$^T$ was found to be Gram-negative, aerobic, greenish-yellow colored, rod-shaped, and motile by means of a single polar flagellum. Growth occurred at $10-40^{\circ}C$ (optimum, $35^{\circ}C$), pH 7.0-8.0 (optimum pH 8.0), and with 0-2.0% NaCl (optimum, 0.5-1.0%). The major fatty acids were $C_{16:1}{\omega}7c$(36.3%), $C_{16:0}$(16.6%), $C_{12:0}$ 3-OH (12.5%), and $C_{18:1}{\omega}7c$(9.1%). The major respiratory quinone was Q-8, and the DNA G+C content of the genomic DNA was 51.9 mol%. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain GR5$^T$ belongs to the genus Rheinheimera, where its most closely related neighbors are Rheinheimera texasensis A62-14B$^T$ and Rheinheimera tangshanensis JA3-B52$^T$ with sequence similarities of 98.1% and 97.5%, respectively, and the sequence similarities to any other recognized species within Gammaproteobacteria are less than 96.5%. The mean level of DNA-DNA relatedness between strain GR5$^T$ and R. texasensis A62-14B$^T$, the strain most closely related to the isolate, was $26.5{\pm}7.6%$. Therefore, based on the phylogenetic and phenotypic data, strain GR5$^T$ should be classified as a novel species, for which the name Rheinheimera aquatica sp. nov. is proposed. The type strain is GR5$^T$ (=BCRC 80081$^T$=LMG 25379$^T$).
Geon-Woo Lee;Sang-Tae Seo;Byeongjin Cha;Sang-Sub Han
Research in Plant Disease
/
v.29
no.4
/
pp.420-424
/
2023
In 2020, within the Dongbaekdongsan area in Jeju Island, a Septobasidium sp. associated with a felt disease in Castanopsis sieboldii (Makino) Hatus. ex T. Yamaz. & Mashiba was identified. The symptom included the presence of brown, thin, and silk-like mycelial mats attached to the tree's bark, displaying variations in size from large to small. To induce hyphal growth, the samples collected were incubated in a moist chamber, and the newly formed hyphae were subjected to genomic DNA extractions. The nucleotide sequences of the internal transcribed spacer and small subunit rDNA genes were determined, and molecular characteristics among the isolates were investigated through polymerase chain reaction-based restriction fragment length polymorphism analysis. This Septobasidium sp. exhibited distinct morphological and phylogenetic features compared to those that were previously reported in South Korea. Consequently, this strain is taxonomically classified as a provisionally novel species of Septobasidium. Furthermore, the observed felt disease exhibited a high degree of host specificity, as it was exclusively identified in C. sieboldii without occurrence in other tree species at the time of observation.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.