• Genomics & Informatics
• /
• v.18 no.4
• /
• pp.41.1-41.8
• /
• 2020

We provide an algorithm for the construction and analysis of autocorrelation (information) functions of gene nucleotide sequences. As a measure of correlation between discrete random variables, we use normalized mutual information. The information functions are indicative of the degree of structuredness of gene sequences. We construct the information functions for selected gene sequences. We find a significant difference between information functions of genes of different types. We hypothesize that the features of information functions of gene nucleotide sequences are related to phenotypes of these genes.

• Journal of information and communication convergence engineering
• /
• v.17 no.1
• /
• pp.14-20
• /
• 2019

Currently, microarray gene expression data take advantage of the sufficient classification of cancers, which addresses the problems relating to cancer causes and treatment regimens. However, the sample size of gene expression data is often restricted, because the price of microarray technology on studies in humans is high. We propose enhancing the gene expression classification of support vector machines with generative adversarial networks (GAN-SVMs). A GAN that generates new data from original training datasets was implemented. The GAN was used in conjunction with nonlinear SVMs that efficiently classify gene expression data. Numerical test results on 20 low-sample-size and very high-dimensional microarray gene expression datasets from the Kent Ridge Biomedical and Array Expression repositories indicate that the model is more accurate than state-of-the-art classifying models.

• Proceedings of the Ginseng society Conference
• /
• 1990.06a
• /
• pp.65-67
• /
• 1990

The sequence of ginseng peptide gene was designed and synthesized by the solid phase plasmid pUC19. Escherichia coli JM101 cells were transformed with above hybrid plasmids. Ampicillin resistant transformants were screened and identified by in situ colony hybridization and Southern blot techinques. Finally the gene sequencing was done by the Sanger dideoxy method using primer extension.

• Proceedings of the KSAR Conference
• /
• 2004.06a
• /
• pp.194-194
• /
• 2004

Tissue-specific expression of the desired gene product in the targrt tissue is central to the concept of bioreactor. One approach is to use a tissue-specific promoter to drive desired gene. To investigate the feasibility of tissue-specific gene expression for bladder using the porcine uroplakin(UPII) promoter and its transcriptional control the efficacy of this promoter as well as well as fragments in regulating gene expression were cell lines using DNA transfection. (omitted)

• Korean Journal of Microbiology
• /
• v.24 no.3
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• Journal of Ginseng Research
• /
• v.14 no.2
• /
• pp.207-209
• /
• 1990

The sequence of ginseng peptide gene was designed and synthesized by the solid phase phosphoramidiate method. Synthetic segments were isolated, pllrified and joined to the plasmid pUC19. E.icherichiu coli JM101 cells were transformed with above hybrid plasmids. AmpiciIBin resistant transformants were screened and identified by in situ colony hybridization and Southern blot techniques. Finally the gene sequencing was done by the Sanger dideoxy method using primer extension.

• Proceedings of the PSK Conference
• /
• 2003.04a
• /
• pp.292.2-293
• /
• 2003

In the gene therapy. viral gene delivery systems are limited in use because of several drawbacks like host immune reactions. Hence, non-viral gene delivery systems such as cationic polymers or synthetic gene carriers are being widely investigated to overcome the problems in the use of viral vectors. We synthesized a new conjugate of polyethyleniminet carrying galactose moieties as a targeting ligand for asialoglycoprotein (ASGP) receptors of hepatocytes. (omitted)

• Proceedings of the Korean Society of Plant Biotechnology Conference
• /
• 2005.11a
• /
• pp.158-158
• /
• 2005

• Molecules and Cells
• /
• v.25 no.4
• /
• pp.462-466
• /
• 2008

Adenoviruses are the most commonly used gene-delivery vectors due to the efficiency of their in vivo gene transfer. Since 1993, about 300 protocols using an adenoviral vector have been performed, although they have yet to be proven effective in clinical trials. The adenovirus-based vector has been continuously improved by modification of the adenoviral genome and capsid, and novel adenovirus-delivery systems, such as the carrier-cell delivery system, have been recently proposed. Adenovirus-based cancer gene therapy is fast becoming one component of a multi-modality treatment approach to advanced cancer, along with surgery, radiotherapy, and chemotherapy.

• Proceedings of the Zoological Society Korea Conference
• /
• 2000.10a
• /
• pp.276.2-277
• /
• 2000

No Abstract, See Full Text