• 제목/요약/키워드: Clubroot disease

검색결과 64건 처리시간 0.021초

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • 제39권1호
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

배추무사마귀병 뿌리혹의 형성에 미치는 온도, 토양수분, 토양 pH, 광의 영향 (Effects of Temperature, Soil Moisture, Soil pH and Light on Root Gall Development of Chinese Cabbage by Plasmodiophora brassicae)

  • 김충회
    • 식물병과 농업
    • /
    • 제5권2호
    • /
    • pp.84-89
    • /
    • 1999
  • Development of root galls of clubroot disease on Chinese cabbage seedlings was first observed 17days after inoculation of Plasmodiophora brassicae at $25^{\circ}C$ 4-11days earlier than at 5, 20, 3$0^{\circ}C$ and 35$^{\circ}C$. Subsequent enlargement of root galls was also fastest at $25^{\circ}C$ and 2$0^{\circ}C$ but delayed at 15$^{\circ}C$ and 3$0^{\circ}C$ or above. Chinese cabbage seedlings with root gall formation showed reduction in number of leaves above ground fresh weight and amount of root hairs but increase in root weight, Root galls development was highest at soil moisture level of 80% of maximum soil moisture capacity than at 60% and 100%. Optimum soil pH for root gall development was pH 6 although root galls were formed at a range of pH 5 to 8. Period of light illumination also affected root gall development with the greatest gall development at 12hr/12hr in light/dark period and the least at 8hr/16hr. Site of root gall formation and gall shape did not differ greatly among treatments of temperature soil moisture pH and light experiments.

  • PDF

New Classification of Plasmodiophora brassicae Races Using Differential Genotypes of Chinese Cabbage

  • Kim, Hun;Choi, Gyung Ja
    • 한국균학회소식:학술대회논문집
    • /
    • 한국균학회 2015년도 춘계학술대회 및 임시총회
    • /
    • pp.28-28
    • /
    • 2015
  • Clubroot disease caused by Plasmodiophora brassicae induces severe losses of cruciferous vegetables worldwide. To control clubroot of Chinese cabbage, many CR (clubroot resistance) F1 hybrid cultivars have been bred and released in Korea, China and Japan. In this study, we determined the race of P. brassicae 12 field isolates, which collected from 10 regions in Korea, using Williams' differential varieties including two cabbage ('Jersey Queen', 'Badger Shipper') and two rutabaga ('Laurentian', 'Whilhelmsburger'). By Williams' differential varieties, 12 clubroot pathogens were assigned into one (GN2), two (HS and YC), two (HN1 and HN2), three (DJ, KS and SS) and four (GS, GN1, JS and PC) isolates for races 1, 2, 4, 5 and 9, respectively. In addition, the degree of resistance of 45 CR cultivars that were from Korea, China and Japan was tested with the 12 isolates. The 45 CR cultivars of Chinese cabbage were differentiated into three genotypes according to their resistance responses. Even though the 12 P. brassicae isolates were same race by Williams' differential varieties, three CR genotypes showed different resistance response to the isolates. These results indicate that races of P. brassicae by Williams' differentials were not related with resistance of CR cultivars, and three CR genotypes represented qualitative resistance to the P. brassicae isolates. CR genotype I including 'CR-Cheongrok' showed resistance to GN1, GN2, JS, GS, HS, DJ and KS isolates and susceptibility to YC, PC, HN1, HN2 and SS isolates. And CR genotype II such as 'Hangkunjongbyungdaebaekchae' was resistant to GN1, GN2, JS, GS, HS, YC, PC and HN1 and susceptible to DJ, KS, SS and HN2. CR genotype III including 'Chunhajangkun' and 'Akimeki' represented resistance to 10 isolates except for SS and HN2 isolates. Based on these results, we selected 'CR-Cheongrok', 'Hangkunjongbyungdaebaekchae', and 'Chunhajangkun' as a representative cultivar of three CR genotypes and 'Norangkimjang' as a susceptible cultivar. Furthermore, we investigated the resistance of 15 lines of Chinese cabbage, which were provided by seed companies, to 11 isolates except for HN1 of P. brassicae. The results showed that three lines were susceptible to all the tested isolates, whereas five, four, and three lines represented the similar responses corresponding to the CR genotypes I, II, and III, respectively; there is no line of Chinese cabbage showing different resistance patterns compared to three CR genotypes. In particular, line 'SS001' showing resistance responses of CR genotype II was a parent of 'Saerona' that have been commercialized as a CR $F_1$ cultivar of Chinese cabbage. Together, we divided 12 isolates of P. brassicae into 4 races, designated by wild type, mutant type 1, mutant type 2, and mutant type 3. Wild type including GN1, GN2, JS, GS, and HS isolates of P. brassicae was not able to infect all the cultivars of three CR genotypes, whereas, mutant type 3 such as SS and HN2 isolates developed severe clubroot disease on all the CR genotype cultivars. To mutant type 1 including DJ and KS isolates, CR genotypes I, II and III were resistant, susceptible and resistant, respectively. In contrast, to mutant type 2 including YC, PS, and HN1 isolates, CR genotypes I, II and III showed susceptibility, resistance and resistance, respectively. Taken together, our results provide the extended knowledge of classification of P. brassicae races, which is useful information for the breeding of resistant crops, with a suggestion that 'Norangkimjang', 'CR-Cheongrok', 'Saerona' and 'Chunhajangkun' cultivars of Chinese cabbage could be used as new race differentials of P. brassicae for clubroot disease assay.

  • PDF

배추무사마귀병균의 토양내 분포 (Distribution of lasmodiophora brassicae Causing clubroot Disease of Chinese Cabbage in Soil)

  • 김충회;조원대;김홍모
    • 식물병연구
    • /
    • 제6권1호
    • /
    • pp.27-33
    • /
    • 2000
  • 심하게 이병된 배추포장내 무사마귀병균의 수직분포를 보면 토양의 심도가 깊어질수록 무사마귀병균의 밀도는 급격히 감소하였으며 무사마귀병균의 97%가 지하 5cm 이내의 표토에 분포하였고 지하 40cm 토양에서도 소량 검출되었다. 수평분포를 보면 무사마귀병균은 배추포기중심에 모여 있다기보다는 전 포장에 골고루 분포하고 있어서 한곳에 몰려 분포하는 현상은 발견되지 않았다. 평창의 23개 배추지역의 무사마귀병균의 밀도는 1$\times$$10^4$포자/g 토양 이하의 밀도가 낮은 곳에서부터 $10^{6}$ 토양이상의 밀도가 높은 포장까지 폭넓게 분포하고 있었다. 작물을 재배하기 않은 처녀지 토양은 밀도가 $10^4$토양 이하로 극히 낮거나 전혀 검출되지 않았으며 심하게 이병된 배추밭의 밀도는 $10^{5}$/g 토양이상으로 대단히 높았다. 건전 배추밭과 배추 이외의 타작물을 재배하고 있는 포장내 밀도는 이보다 상당히 낮아서 심고 있는 작물에 따라서 토양내 무사마귀병균 밀도에 큰 차이가 있었다 작부체계별 밀도분포를 보면 다소 예외는 있으나 배추, 무 등의 기주작물을 연작한 곳일수록 밀도가 높게 나타났으며, 약초, 옥수수, 메밀, 기타 채소 등 비기주작물을 재배한 곳일수록 무사마귀병균의 밀도가 낮은 곳이 많았다. 배추, 무 등의 기주작물을 연작하면 토양내 무사마귀병균의 밀도는 점차 상승하는 경향이었고 반면에 당귀, 메밀 등 비기주작물로 윤작한 포장의 밀도는 급격히 감소하는 경향이어서 무사마귀병균의 토양내 생존은 작부체계에 의해 크게 영향을 받고 있는 것으로 나타났다. 본 연구에서 사용한 개량형광염색방법은 기존의 방법에 비해 토양내 휴면포자의 식별이 보다 용이해졌을 뿐만 아니라 그 검출효율도 증진되었고 조작이 간편하여 큰 숙련없이 밀도를 측정할 수 있어 향후 토양내 무사마귀병균의 동태를 연구하는데 유용하게 이용될 수 있을 것으로 생각된다.다.

  • PDF

양배추 및 브로콜리 뿌리혹병에 대한 효율적인 저항성 검정 방법 확립 (Development of Efficient Screening Method for Resistant Cabbage and Broccoli to Plasmodiophora brassicae)

  • 조수정;심선아;장경수;최용호;김진철;최경자
    • 식물병연구
    • /
    • 제18권2호
    • /
    • pp.86-92
    • /
    • 2012
  • Plasmodiophora brassicae Woron.에 의한 뿌리혹병은 배추과 작물에 발생하는 전 세계적으로 가장 중요한 식물병 중 하나이다. 본 연구는 Brassica oleracea에 속하는 양배추와 브로콜리의 뿌리혹병에 대한 효율적인 저항성 검정 방법을 확립하기 위하여, 레이스 9인 GN1 균주를 이용하여 접종원의 농도와 P. brassicae 접종 후 배양 기간 등의 발병 조건에 따른 양배추와 브로콜리 뿌리혹병 발생을 조사하였다. 접종원의 농도는 14일 재배한 유묘에 포트 당 $2.5{\times}10^9$개의 포자를 접종하는 것이 적당하였으며, 안정적인 발병을 위하여 접종한 유묘는 3일 동안 $20^{\circ}C$ 생육상에서 하루에 12시간 광을 처리하며 배양하고, 그 후 온실($20{\pm}5^{\circ}C$)에서 5주 동안 재배한 후에 발병 정도를 조사하는 것이 요구되었다. 위의 검정법을 이용하여 레이스가 다른 P. brassicae 4개 포장 균주에 대한, 시판 중인 양배추 16종과 브로콜리 17종 품종의 저항성 정도를 실험한 결과, 레이스 9인 GN1, GN2 그리고 GS 균주에 대해서는 중도저항성을 보이는 몇 가지 품종이 있었다. 그러나 레이스 2인 YC 균주에 대해서는 실험한 모든 품종이 고도의 감수성 반응을 나타내었다. 따라서 이 방법은 양배추와 브로콜리 뿌리혹병 저항성을 검정하기 위한 효율적인 검정법이라는 것을 알 수 있었다.

배추 무사마귀병 발병 억제 및 생육증진을 위한 달걀껍질 토양혼화처리 효과 (Soil-blending Effect of Eggshell Powder on the Control of Club root Disease and the Growth of Chinese Cabbage in the Field)

  • 가모유량;김병관;임태헌;리규화;백기엽;차병진
    • 식물병연구
    • /
    • 제15권2호
    • /
    • pp.106-111
    • /
    • 2009
  • 무사마귀병이 상습적으로 발생하는 농가포장에 달걀껍질을 토양혼화 처리한 후 배추를 정식하고 $10{\sim}13$일 간격으로 4회에 걸쳐 배추를 수확하여 무사마귀병 발병과 배추생육, 토양 pH 변화 등을 조사한 결과 지상부 생육에 있어서 난막을 제거한 달걀껍질 처리구의 배추들이 시험중기부터 다른 처리구들에 비하여 빠른 생육을 보였으며, 무사마귀병 발병도도 가장 낮았다. 난막이 있는 달걀껍질 처리구는 무처리 대조구보다는 생육이 좋았으나 난막 없는 달걀껍질 처리구보다는 낮았다. 토양 pH는 처리 3주 이후부터 차이가 커지기 시작하여, 난막 없는 달걀껍질 처리구에서는 8.0 이상으로 상승한 반면 무처리구에서는 6.8 정도에 머물렀다. 달걀껍질과 기타 칼슘화합물의 효과를 비교한 시험에서는 $CaCO_3$ 처리구의 발병도가 1.7로 가장 낮았고, 무사마귀병 방제용 살균제인 플루설파마이드 처리구와 무사마귀병 저항성 품종인 CR그린배추의 발병도가 모두 1.9인 반면, 달걀껍질 처리구의 발병도는 2.7로 높은 편이었다. 무처리 대조구의 발병도는 3.4였다. 그러나 배추 생육은 발병도와는 다른 양상을 보여, 달걀껍질 처리구의 배추 생육이 약 2.1kg으로 가장 좋았던 반면 무사마귀병 저항성 품종인 CR그린배추의 생육은 약 2.0 kg, 무사마귀병 방제용 살균제인 플루설파마이드 처리구에서는 약 1.7 kg, 그리고 무처리 대조구에서는 약 1.3 kg에 머물렀다. 달걀껍질은 무사마귀병을 크게 억제하지는 못하여도 배추의 생육을 증진시키는 효과는 매우 컸다. 따라서, 배추를 정식하기 전에 토양에 달걀껍질을 혼화한다면 무사마귀병 발생에 관계없이 배추를 재배가 가능할 것이다.

효율적인 무 뿌리혹병 저항성 검정법 확립 (Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae)

  • 조수정;장경수;최용호;김진철;최경자
    • 식물병연구
    • /
    • 제17권2호
    • /
    • pp.161-168
    • /
    • 2011
  • Plasmodiophora brassicae Woron.에 의해 발생하는 무 뿌리혹병에 대한 효율적인 저항성 검정법을 확립하기 위하여, GN-1 균주를 사용하여 접종원 농도, 무 생육 시기 및 접종 후 배양 기간 등 발병 조건에 따른 무 뿌리혹병발생을 조사하였다. 종자를 파종하고 10일 동안 재배한 무 유묘에 뿌리혹병균을 포트 당 $1.0{\times}10^9$개의 포자 농도가 되도록 관주하여 접종하였을 때 뿌리혹병이 가장 많이 발생하였다. 그리고 뿌리혹병 발생을 위해서, 접종한 무 유묘는 $20^{\circ}C$ 생육상에서 하루에 12시간 동안 광을 처리하며 3일 동안 배양하고, 그 후 온실($20{\pm}5^{\circ}C$)에서 6주 동안 재배한 후에 발병 정도를 조사하는 것이 효율적이었다. 확립한 무 뿌리혹병 저항성 검정법을 이용하여, 시판 중인 무 품종 46개의 P. brassicae GN-1 균주(저항성 배추 품종을 침입할 수 없는 균주)와 YC-1 균주(15개 저항성 배추 품종에 뿌리혹병을 일으키는 균주)에 대한 저항성 정도를 실험한 결과, 실험한 무 품종 중 35개 품종은 두 균주 모두에 대하여 저항성을, 그리고 1개 품종은 감수성을 나타내었다. 한편, 나머지 10개 품종은 균주에 따라 서로 다른 반응을 나타냈다. 이상의 결과로부터 본 연구에서 확립한 뿌리혹병 저항성 검정법은 뿌리혹병균에 대한 무의 저항성을 조사하기 위한 효율적인 방법임을 알 수 있었다.

Flusulfamide입제에 의한 배추무사마귀병의 방제효과 (Control Efficacy of Flusulfamide GR on Chinese Cabbage Clubroot Caused by Plasmodiophora brassicae)

  • 장현철;이선욱;김점순;윤여순;최근숙;김학기;김병섭
    • 식물병연구
    • /
    • 제11권1호
    • /
    • pp.43-47
    • /
    • 2005
  • Flisulfamide 입제의 포장에서 방제효과 변화를 조사하기 위하여 강릉신의 배추 뿌리혹병에 오염된 고랭지 포장에서 본 시험을 진행하였다. Flisulfamide 입제는 84.6% 의 방제가로 무처리구와 기타 대조약제에 비교하여 통계적으로 유의성이 있는 것으로 나타났다. 휴면포자의 감소율을 조사하기 위하여 시험포장의 모든 처리구의 각 반복당 임의의 5개 지점에서 약제 처리 전 토양과 약제 처리 후 토양을 채집하여, 토양내의 휴면포자의 밀도를 조사하였다. 처리 전 시험 포자으이 휴면포자 밀도는 균일하지 않았으므로 포장 시험시 처리전 휴면포자 밀도의 조사가 필요하다고 생각된다. 휴면포자의 감소율을 조사한 결과, flisulfamide 분제와 입제를 처리한 후 휴면포자 밀도는 처리전에 비하여 63.7% 와 64.2% 의 감소율을 나타냈다. 방제효과와 휴면포자의 감소율간에는 유효적인 상관관계가 있게 나타났다. 그리고 약제 처리에 의한 수확량 변화를 조사하기 위하여, 약제 처리 45일 후, 각 처리구에서 20주의 배추를 수확하여 지상부 무게를 측정하였다. Flisulfamide 분제, fluazinam 분재와 flisulfamide 입제의 처리구에서 수확량은 무처리구에 비하여 14.3%, 13.8%와 13.0% 의 수확량 증가율을 나타냈고, trifloxystrobin 액상수화제의 처리구에서 수확량은 무처리구에 비하여 3.8%의 증가율을 나타냈다. 대조구를 포함한 각 처리평균간에는 통계적 유의성(P=0.05)은 없는 것으로 나타났다. 이상의 결과로부터 flisulfamide 입제가 배추 뿌리혹병의 방제에 있어서 우수한 방제효과를 가지고 있으며, 또한 휴면포자의 밀도를 감소하는데 효과적임을 알 수 있다.

달걀껍질이 배추의 생육과 무사마귀병 발병억제에 미치는 영향 (Effects of Eggshell Powder on Clubroot Disease Control and the Growth of Chinese Cabbage)

  • 김병관;임태헌;김윤희;박석환;이상화;차병진
    • 식물병연구
    • /
    • 제14권3호
    • /
    • pp.193-200
    • /
    • 2008
  • 달걀껍질을 1:5, 1:10, 1:15, 1:20, 1:25의 비율로 토양에 혼화처리 하였을 때 배추를 비롯한 몇 가지 작물의 종자 발아율에는 별다른 변화가 없었다. 달걀껍질 혼화수용액의 pH는 증가하였으며, 수용액의 pH가 증가할수록 Plasmodiophora brassicae의 휴면포자 활성율은 감소하였는데, 달걀껍질 혼화수용액에서의 불활성화율이 같은 pH의 수용액에서의 불활성화율보다 5배 이상 높았다. '노랑 봄배추'는 달걀껍질을 토양에 혼화하였을 때 무처리에 비하여 생육이 증가한 반면, 다른 작물들의 생육은 달걀껍질 처리구에서 무처리보다 저조하였다. '노랑봄배추'는 달걀껍질을 $1:20{\sim}1:15$로 토양에 혼화하였을 때 엽수는 무처리의 약 150%, 지상부 생체중은 무처리의 약 470% 증가율을 보였다. 토양에 혼화한 달걀껍질 입자의 크기는 $0.8{\sim}2.0mm$일 때 배추 생장에, 그리고 0.4 mm 이하일 때 병 억제율에 가장 좋은 영향을 미쳤으나, 입자의 크기간에 통계적 유의차는 없었다. 토양의 pH는 모든 달걀껍질 처리구에서 8.0 이상으로 높게 나타났으며, 혼화비율에 따른 통계적 유의차는 보이지 않았다. 무사마귀병 방제가는 달걀껍질 1:20 처리구에서 58.5%로 공시살균제인 혹안나 처리구의 78.5% 보다는 낮았으나 배추의 지상부 생육에 있어서는 모든 달걀껍질 처리구에서 무처리나 대조약제 처리구 보다 높았다. 따라서 달걀껍질의 토양혼화는 배추 무사마귀병을 완전히 방제하지는 못하지만 배추의 생육을 촉진하여 감염포장에서도 배추 수확을 가능하게 할 수 있을 것으로 보인다.

Brief Introduction of Research Progresses in Control and Biocontrol of Clubroot Disease in China

  • He, Yueqiu;Wu, Yixin;He, Pengfei;Li, Xinyu
    • 한국균학회소식:학술대회논문집
    • /
    • 한국균학회 2015년도 춘계학술대회 및 임시총회
    • /
    • pp.45-46
    • /
    • 2015
  • Clubroot disease of crucifers has occurred since 1957. It has spread to the whole China, especially in the southwest and nourtheast where it causes 30-80% loss in some fields. The disease has being expanded in the recent years as seeds are imported and the floating seedling system practices. For its effective control, the Ministry of Agriculture of China set up a program in 2010 and a research team led by Dr. Yueqiu HE, Yunnan Agricultural University. The team includes 20 main reseachers of 11 universities and 5 institutions. After 5 years, the team has made a lot of progresses in disease occurrence regulation, resources collection, resistance identification and breeding, biological agent exploration, formulation, chemicals evaluation, and control strategy. About 1200 collections of local and commercial crucifers were identified in the field and by artificiall inoculation in the laboratories, 10 resistant cultivars were breeded including 7 Chinese cabbages and 3 cabbages. More than 800 antagostic strains were isolated including bacteria, stretomyces and fungi. Around 100 chemicals were evaluated in the field and greenhouse based on its control effect, among them, 6 showed high control effect, especially fluazinam and cyazofamid could control about 80% the disease. However, fluzinam has negative effect on soil microbes. Clubroot disease could not be controlled by bioagents and chemicals once when the pathogen Plasmodiophora brassicae infected its hosts and set up the parasitic relationship. We found the earlier the pathogent infected its host, the severer the disease was. Therefore, early control was the most effective. For Chinese cabbage, all controlling measures should be taken in the early 30 days because the new infection could not cause severe symptom after 30 days of seeding. For example, a biocontrol agent, Bacillus subtilis Strain XF-1 could control the disease 70%-85% averagely when it mixed with seedling substrate and was drenching 3 times after transplanting, i.e. immediately, 7 days, 14 days. XF-1 has been deeply researched in control mechanisms, its genome, and development and application of biocontrol formulate. It could produce antagonistic protein, enzyme, antibiotics and IAA, which promoted rhizogenesis and growth. Its The genome was sequenced by Illumina/Solexa Genome Analyzer to assembled into 20 scaffolds then the gaps between scaffolds were filled by long fragment PCR amplification to obtain complet genmone with 4,061,186 bp in size. The whole genome was found to have 43.8% GC, 108 tandem repeats with an average of 2.65 copies and 84 transposons. The CDSs were predicted as 3,853 in which 112 CDSs were predicted to secondary metabolite biosynthesis, transport and catabolism. Among those, five NRPS/PKS giant gene clusters being responsible for the biosynthesis of polyketide (pksABCDEFHJLMNRS in size 72.9 kb), surfactin(srfABCD, 26.148 kb, bacilysin(bacABCDE 5.903 kb), bacillibactin(dhbABCEF, 11.774 kb) and fengycin(ppsABCDE, 37.799 kb) have high homolgous to fuction confirmed biosynthesis gene in other strain. Moreover, there are many of key regulatory genes for secondary metabolites from XF-1, such as comABPQKX Z, degQ, sfp, yczE, degU, ycxABCD and ywfG. were also predicted. Therefore, XF-1 has potential of biosynthesis for secondary metabolites surfactin, fengycin, bacillibactin, bacilysin and Bacillaene. Thirty two compounds were detected from cell extracts of XF-1 by MALDI-TOF-MS, including one Macrolactin (m/z 441.06), two fusaricidin (m/z 850.493 and 968.515), one circulocin (m/z 852.509), nine surfactin (m/z 1044.656~1102.652), five iturin (m/z 1096.631~1150.57) and forty fengycin (m/z 1449.79~1543.805). The top three compositions types (contening 56.67% of total extract) are surfactin, iturin and fengycin, in which the most abundant is the surfactin type composition 30.37% of total extract and in second place is the fengycin with 23.28% content with rich diversity of chemical structure, and the smallest one is the iturin with 3.02% content. Moreover, the same main compositions were detected in Bacillus sp.355 which is also a good effects biocontol bacterial for controlling the clubroot of crucifer. Wherefore those compounds surfactin, iturin and fengycin maybe the main active compositions of XF-1 against P. brassicae. Twenty one fengycin type compounds were evaluate by LC-ESI-MS/MS with antifungal activities, including fengycin A $C_{16{\sim}C19}$, fengycin B $C_{14{\sim}C17}$, fengycin C $C_{15{\sim}C18}$, fengycin D $C_{15{\sim}C18}$ and fengycin S $C_{15{\sim}C18}$. Furthermore, one novel compound was identified as Dehydroxyfengycin $C_{17}$ according its MS, 1D and 2D NMR spectral data, which molecular weight is 1488.8480 Da and formula $C_{75}H_{116}N_{12}O_{19}$. The fengycin type compounds (FTCPs $250{\mu}g/mL$) were used to treat the resting spores of P. brassicae ($10^7/mL$) by detecting leakage of the cytoplasm components and cell destruction. After 12 h treatment, the absorbencies at 260 nm (A260) and at 280 nm (A280) increased gradually to approaching the maximum of absorbance, accompanying the collapse of P. brassicae resting spores, and nearly no complete cells were observed at 24 h treatment. The results suggested that the cells could be lyzed by the FTCPs of XF-1, and the diversity of FTCPs was mainly attributed to a mechanism of clubroot disease biocontrol. In the five selected medium MOLP, PSA, LB, Landy and LD, the most suitable for growth of strain medium is MOLP, and the least for strains longevity is the Landy sucrose medium. However, the lipopeptide highest yield is in Landy sucrose medium. The lipopeptides in five medium were analyzed with HPLC, and the results showed that lipopeptides component were same, while their contents from B. subtilis XF-1 fermented in five medium were different. We found that it is the lipopeptides content but ingredients of XF-1 could be impacted by medium and lacking of nutrition seems promoting lipopeptides secretion from XF-1. The volatile components with inhibition fungal Cylindrocarpon spp. activity which were collect in sealed vesel were detected with metheds of HS-SPME-GC-MS in eight biocontrol Bacillus species and four positive mutant strains of XF-1 mutagenized with chemical mutagens, respectively. They have same main volatile components including pyrazine, aldehydes, oxazolidinone and sulfide which are composed of 91.62% in XF-1, in which, the most abundant is the pyrazine type composition with 47.03%, and in second place is the aldehydes with 23.84%, and the third place is oxazolidinone with 15.68%, and the smallest ones is the sulfide with 5.07%.

  • PDF