• Title/Summary/Keyword: Clubroot(Plasmodiophora brassicae)

Search Result 62, Processing Time 0.017 seconds

Occurrence of Clubroot on Shepherd's-purse Caused by Plasmodiophora brassicae

  • Kim, Wan-Gyu;Lee, Sang-Yeob;Choi, Hyo-Won;Hong, Sung-Kee;Lee, Young-Kee
    • Mycobiology
    • /
    • v.39 no.3
    • /
    • pp.233-234
    • /
    • 2011
  • Clubroot symptoms were frequently observed on roots of shepherd's-purse (Capsella bursa-pastoris) grown in a field in Nonsan, Chungnam province, Korea in March, 2009. Many resting spores were found in the cells of the root gall tissues collected from the field. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that P. brassicae causes clubroot of shepherd's-purse in Korea.

Occurrence of Clubroot on Pak-Choi Caused by Plasmodiophora brassicae

  • Kim, Wan-Gyu;Moon, Mi-Hwa;Kim, Jin-Hee;Choi, Hyo-Won;Hong, Sung-Kee
    • Mycobiology
    • /
    • v.37 no.1
    • /
    • pp.69-71
    • /
    • 2009
  • Clubroot symptoms occurred severely on roots of Pak-Choi (Brassica campestris ssp. chinensis) grown in greenhouses in Gwangju city, Gyeonggi province, Korea in September, 2008. The incidence of the disease symptoms reached as high as 90% in three greenhouses investigated. The root galls collected from the greenhouses were sectioned using a scalpel and observed by light microscope. Many resting spores were found in the cells of the root gall tissues. Suspension of resting spores was prepared from the root galls and inoculated to roots of healthy Pak-Choi plants. Each of five resting spore suspensions caused clubroot symptoms on the roots, which were similar to those observed during the greenhouse survey. Resting spores of the pathogen were observed in the cells of the affected roots. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that Plasmodiophora brassicae causes clubroot of Pak-Choi.

Occurrence of Clubroot Caused by Plasmodiophora brassicae in Baecheongchae

  • Kim, Wan-Gyu;Oh, Sang-Keun;Semunyana, Marc;Han, Man-Jong;Lee, Gyo-Bin;Cho, Weon-Dae
    • The Korean Journal of Mycology
    • /
    • v.48 no.4
    • /
    • pp.499-503
    • /
    • 2020
  • Clubroot symptoms were frequently observed on the roots of Baecheongchae plants grown in vinyl greenhouses of a farmer located in Yangpyeong area of Korea during a disease survey in June 2019. The incidence of diseased Baecheongchae plants ranged from 30 to 90% in the vinyl greenhouses investigated. Many resting spores were found in the tissue of root galls collected. The resting spores were hyaline and spherical and measured 2.5-4.2 ㎛ in diameter. Three inoculum suspensions of resting spores prepared from the root galls were inoculated to the roots of healthy Baecheongchae plants. All the inoculum suspensions caused clubroot symptoms to appear on the roots of the inoculated Baecheongchae plants. The symptoms on the roots induced by artificial inoculation were similar to those observed in the plants of the vinyl greenhouses during the disease survey. Resting spores of the pathogen were recovered from the root galls of the inoculated plants. Three root gall isolates obtained from the inoculated plants were used for molecular identification. Comparing the isolates to the Plasmodiophora brassicae strains in GenBank, the amplification products demonstrated 100% similarity with the internal transcribed spacer (ITS2) sequences. The clubroot pathogen was identified as P. brassicae according to its morphological, pathological, and molecular characteristics. This is the first report of P. brassicae causing clubroot in Baecheongchae.

Detection of Plasmodiophora brassicae by Using Polymerase Chain Reaction (PCR을 이용한 Plasmodiophora brassicae의 검출)

  • 지희윤;김완규;조원대;지형진;최용철
    • Korean Journal Plant Pathology
    • /
    • v.14 no.6
    • /
    • pp.589-593
    • /
    • 1998
  • DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.

  • PDF

Incidence, Pathogenicity of Clubroot Fungus(Plasmodiophora brassicae) and Varietal Resistance in Chinese Cabbage (배추 무사마귀병의 발생상황과 병원균(Plasmodiophora brassicae)의 병원성 및 배추품종의 병저항성)

  • 김두욱;오정행
    • Korean Journal Plant Pathology
    • /
    • v.13 no.2
    • /
    • pp.95-99
    • /
    • 1997
  • To obtain a basic information of breeding for resistance to clubroot in Chinese cabbage, disease incidence, pathogenicity, and varietal response to the pathogen were studied. Incidence of clubroot was observed at 3 districts in Gyeonggi-Do, 2 districts in Kangwon-Do, and 1 district each in Gyeongnam, Geongbuk and Jeonbuk, respectively. Disease infection rate and diseased ara were most severe in northern part of Gyeonggi-Do. The isolates of clubroot collected from 8 different districts were not different in their virulence one another in view of their infection rate and disease severity in Chinese cabbage. The clubroot fungus had a wide host range for the cruciferous vegetables. Disease severity was high in rape, turnip and mustard, moderate in Chinese cabbage and broccoli, and low in kale and cauliflower. All of Korean hybrids of Chinese cabbage tested were highly susceptible to clubroot, but Japanese varieties were resistant to the highly pathogenic isolate (EJ-93) which was isolated from the Chinese cabbage in Korea. The hybrid(F1) between clubroot resistant line(930WG) and the susceptible line(332MS) showed completely resistant reaction, which indicated that clubroot resistance was governed by a dominant gene.

  • PDF

Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage (배추 뿌리혹병균 Plasmodiophora brassicae의 종 특이적 프라이머 개발)

  • Choi, Jin Su;Yang, Seul Gi;Song, Jeong Young;Kim, Hong Gi
    • Research in Plant Disease
    • /
    • v.20 no.1
    • /
    • pp.21-24
    • /
    • 2014
  • Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

Optimal Storage Condition of Clubroot Pathogen, Plasmodiophora brassicae for Artificial Inoculation (배추뿌리혹병균(Plasmodiophora brassicae)의 인공접종을 위한 효율적인 저장조건)

  • Yang, Seul Gi;Park, Ju Young;Seo, Mun Won;Kim, Hong Gi
    • The Korean Journal of Mycology
    • /
    • v.43 no.4
    • /
    • pp.286-289
    • /
    • 2015
  • Clubroot, caused by the obligate parasite Plasmodiophora brassicae, is a severe soilborne disease of Brassicaceae. Storage of clubroot gall is important for studies on pathogenicity and race identification. As the current storage method has been used for more than 100 years, a new storage method should be developed and the most efficient way maintaining pathogenicity should be determined. Effects of storage conditions with different storage periods on pathogenicity in galls of kimchi cabbage were examined in a greenhouse. The experiments were performed under six conditions and four temperatures in order to determine the most effective storage conditions for maintenance of pathogenicity. The most effective conditions for clubroot gall storage was the storage of whole gall at $-70^{\circ}C$ or storage of filtrate at the same temperature through eight layers of gauze after homogenization of the galls.

Ocurrence of Clubroot Caused by Plasmodiophora brassicae on Kohlrabi in Korea (Plasmodiophora brassicae에 의한 콜라비 뿌리혹병 발생)

  • Song, MinA;Choi, InYoung;Song, JeongHeub;Lee, KuiJae;Shin, HyeonDong;Galea, Victor
    • Research in Plant Disease
    • /
    • v.25 no.1
    • /
    • pp.33-37
    • /
    • 2019
  • From 2016 to 2018, approximately 15% of kohlrabi were observed displaying significant clubroot symptoms in farmer's fields in Jeju, Korea. The initial infection appeared as hypertrophy of root hairs, and as the disease progressed, galls formation occurred on the main roots, finally disease progress resulted in yellowing and wilting of leaves. Pathogenicity was proven by artificial inoculation of plants with resting spore suspension, fulfilling Koch's postulates. The resting spore is one-celled, spherical and subspherical, colorless, and $3-5{\mu}m$ in diameter. On the basis of the morphological characteristics and phylogenetic analyses of internal transcribed spacer rDNA, the causal agent was identified as Plasmodiophora brassicae. To our knowledge, this is the first report on the occurrence of P. brassicae on kohlrabi in Korea.

Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae

  • Kim, Hee-Jong;Lee, Youn-Su
    • Journal of Microbiology
    • /
    • v.39 no.1
    • /
    • pp.56-61
    • /
    • 2001
  • Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.

  • PDF

Convenient Screening Method of Chinese Cabbage for Resistance to Plasmodiophora brassicae Using Soil-Drenching Inoculation (관주 접종법을 이용한 효율적인 배추 뿌리혹병 저항성 검정법)

  • Jo, Su-Jung;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
    • Research in Plant Disease
    • /
    • v.16 no.3
    • /
    • pp.279-284
    • /
    • 2010
  • Clubroot caused by Plasmodiophora brassicae is a widespread disease that causes serious problems in many brassica growing areas. To establish more simple and reliable clubroot screening method of Chinese cabbage to P. brassicae using soil-drenching inoculation, the development of clubroot on Chinese cabbage according to several conditions such as soil type, inoculum concentration of P. brassicae GN-1 (race 9), plant growth stage and incubation period was studied. In a commercial horticulture nursery media soil (CNS), disease severity of the seedling according to inoculum concentration increased in a dose-dependent manner, but did not in mixture of CNS and upland soil (1:1, v/v). To facilitate and acquire precise result of resistance screening of Chinese cabbage to clubroot, 10-day-old seedlings should be inoculated by drenching the spore suspension of P. brassicae to give inoculum density of $4.0{\times}10^8$ spores/pot. To develop the disease, the inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days, and then cultivated in a greenhouse ($25{\pm}5^{\circ}C$) for five weeks. Under the optimum conditions, 25 clubroot-resistant (CR) and 3 clubroot-susceptible (CS) cultivars were tested for resistance to P. brassicae. All CR cultivars showed very clear resistance response, on the other hand all CS cultivars severly infected with the pathogen. The results suggest that this method is efficient screening method of Chinese cabbage for resistance to clubroot disease.