Kim, Wan-Gyu;Lee, Sang-Yeob;Choi, Hyo-Won;Hong, Sung-Kee;Lee, Young-Kee
Mycobiology
/
v.39
no.3
/
pp.233-234
/
2011
Clubroot symptoms were frequently observed on roots of shepherd's-purse (Capsella bursa-pastoris) grown in a field in Nonsan, Chungnam province, Korea in March, 2009. Many resting spores were found in the cells of the root gall tissues collected from the field. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that P. brassicae causes clubroot of shepherd's-purse in Korea.
Kim, Wan-Gyu;Moon, Mi-Hwa;Kim, Jin-Hee;Choi, Hyo-Won;Hong, Sung-Kee
Mycobiology
/
v.37
no.1
/
pp.69-71
/
2009
Clubroot symptoms occurred severely on roots of Pak-Choi (Brassica campestris ssp. chinensis) grown in greenhouses in Gwangju city, Gyeonggi province, Korea in September, 2008. The incidence of the disease symptoms reached as high as 90% in three greenhouses investigated. The root galls collected from the greenhouses were sectioned using a scalpel and observed by light microscope. Many resting spores were found in the cells of the root gall tissues. Suspension of resting spores was prepared from the root galls and inoculated to roots of healthy Pak-Choi plants. Each of five resting spore suspensions caused clubroot symptoms on the roots, which were similar to those observed during the greenhouse survey. Resting spores of the pathogen were observed in the cells of the affected roots. The clubroot pathogen was identified as Plasmodiophora brassicae based on its morphological and pathological characteristics. This is the first report that Plasmodiophora brassicae causes clubroot of Pak-Choi.
Kim, Wan-Gyu;Oh, Sang-Keun;Semunyana, Marc;Han, Man-Jong;Lee, Gyo-Bin;Cho, Weon-Dae
The Korean Journal of Mycology
/
v.48
no.4
/
pp.499-503
/
2020
Clubroot symptoms were frequently observed on the roots of Baecheongchae plants grown in vinyl greenhouses of a farmer located in Yangpyeong area of Korea during a disease survey in June 2019. The incidence of diseased Baecheongchae plants ranged from 30 to 90% in the vinyl greenhouses investigated. Many resting spores were found in the tissue of root galls collected. The resting spores were hyaline and spherical and measured 2.5-4.2 ㎛ in diameter. Three inoculum suspensions of resting spores prepared from the root galls were inoculated to the roots of healthy Baecheongchae plants. All the inoculum suspensions caused clubroot symptoms to appear on the roots of the inoculated Baecheongchae plants. The symptoms on the roots induced by artificial inoculation were similar to those observed in the plants of the vinyl greenhouses during the disease survey. Resting spores of the pathogen were recovered from the root galls of the inoculated plants. Three root gall isolates obtained from the inoculated plants were used for molecular identification. Comparing the isolates to the Plasmodiophora brassicae strains in GenBank, the amplification products demonstrated 100% similarity with the internal transcribed spacer (ITS2) sequences. The clubroot pathogen was identified as P. brassicae according to its morphological, pathological, and molecular characteristics. This is the first report of P. brassicae causing clubroot in Baecheongchae.
DNA amplification by polymerase chain reaction (PCR) was used to specifically detect Plasmodiophora brassicae, causing clubroot of crucifers. On the basis of DNA sequence informations, an oligonucleotide primer set specific for the pathogen was designed form small subunit gene (18S-like) and internal transcribed spacer (ITS) region of ribosomal DNA. Primer ITS 5/PB-C produced an amplification product of approximately 520 bp in length with DNA from P. brassicae. However, no amplification product was produced with DNAs from several soil-borne fungi, Didymella bryoniae and Rhizopus stolonifer. Using these primers, the clubroot pathogen was readily detected from infected roots of crucifers, but not from healthy roots. Southern hybridization analysis further confirmed that the amplification product was originated from P. brassicae.
To obtain a basic information of breeding for resistance to clubroot in Chinese cabbage, disease incidence, pathogenicity, and varietal response to the pathogen were studied. Incidence of clubroot was observed at 3 districts in Gyeonggi-Do, 2 districts in Kangwon-Do, and 1 district each in Gyeongnam, Geongbuk and Jeonbuk, respectively. Disease infection rate and diseased ara were most severe in northern part of Gyeonggi-Do. The isolates of clubroot collected from 8 different districts were not different in their virulence one another in view of their infection rate and disease severity in Chinese cabbage. The clubroot fungus had a wide host range for the cruciferous vegetables. Disease severity was high in rape, turnip and mustard, moderate in Chinese cabbage and broccoli, and low in kale and cauliflower. All of Korean hybrids of Chinese cabbage tested were highly susceptible to clubroot, but Japanese varieties were resistant to the highly pathogenic isolate (EJ-93) which was isolated from the Chinese cabbage in Korea. The hybrid(F1) between clubroot resistant line(930WG) and the susceptible line(332MS) showed completely resistant reaction, which indicated that clubroot resistance was governed by a dominant gene.
Choi, Jin Su;Yang, Seul Gi;Song, Jeong Young;Kim, Hong Gi
Research in Plant Disease
/
v.20
no.1
/
pp.21-24
/
2014
Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.
Yang, Seul Gi;Park, Ju Young;Seo, Mun Won;Kim, Hong Gi
The Korean Journal of Mycology
/
v.43
no.4
/
pp.286-289
/
2015
Clubroot, caused by the obligate parasite Plasmodiophora brassicae, is a severe soilborne disease of Brassicaceae. Storage of clubroot gall is important for studies on pathogenicity and race identification. As the current storage method has been used for more than 100 years, a new storage method should be developed and the most efficient way maintaining pathogenicity should be determined. Effects of storage conditions with different storage periods on pathogenicity in galls of kimchi cabbage were examined in a greenhouse. The experiments were performed under six conditions and four temperatures in order to determine the most effective storage conditions for maintenance of pathogenicity. The most effective conditions for clubroot gall storage was the storage of whole gall at $-70^{\circ}C$ or storage of filtrate at the same temperature through eight layers of gauze after homogenization of the galls.
Song, MinA;Choi, InYoung;Song, JeongHeub;Lee, KuiJae;Shin, HyeonDong;Galea, Victor
Research in Plant Disease
/
v.25
no.1
/
pp.33-37
/
2019
From 2016 to 2018, approximately 15% of kohlrabi were observed displaying significant clubroot symptoms in farmer's fields in Jeju, Korea. The initial infection appeared as hypertrophy of root hairs, and as the disease progressed, galls formation occurred on the main roots, finally disease progress resulted in yellowing and wilting of leaves. Pathogenicity was proven by artificial inoculation of plants with resting spore suspension, fulfilling Koch's postulates. The resting spore is one-celled, spherical and subspherical, colorless, and $3-5{\mu}m$ in diameter. On the basis of the morphological characteristics and phylogenetic analyses of internal transcribed spacer rDNA, the causal agent was identified as Plasmodiophora brassicae. To our knowledge, this is the first report on the occurrence of P. brassicae on kohlrabi in Korea.
Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set foam the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCCTTTGA (PB-2). This primer set was used to specifically detect p. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia app., as well as bacteria such as Pseudomonas app. and Erwinia sup. did not show any reaction with the primer set.
Jo, Su-Jung;Jang, Kyoung-Soo;Choi, Yong-Ho;Kim, Jin-Cheol;Choi, Gyung-Ja
Research in Plant Disease
/
v.16
no.3
/
pp.279-284
/
2010
Clubroot caused by Plasmodiophora brassicae is a widespread disease that causes serious problems in many brassica growing areas. To establish more simple and reliable clubroot screening method of Chinese cabbage to P. brassicae using soil-drenching inoculation, the development of clubroot on Chinese cabbage according to several conditions such as soil type, inoculum concentration of P. brassicae GN-1 (race 9), plant growth stage and incubation period was studied. In a commercial horticulture nursery media soil (CNS), disease severity of the seedling according to inoculum concentration increased in a dose-dependent manner, but did not in mixture of CNS and upland soil (1:1, v/v). To facilitate and acquire precise result of resistance screening of Chinese cabbage to clubroot, 10-day-old seedlings should be inoculated by drenching the spore suspension of P. brassicae to give inoculum density of $4.0{\times}10^8$ spores/pot. To develop the disease, the inoculated seedlings were incubated in a growth chamber at $20^{\circ}C$ for 3 days, and then cultivated in a greenhouse ($25{\pm}5^{\circ}C$) for five weeks. Under the optimum conditions, 25 clubroot-resistant (CR) and 3 clubroot-susceptible (CS) cultivars were tested for resistance to P. brassicae. All CR cultivars showed very clear resistance response, on the other hand all CS cultivars severly infected with the pathogen. The results suggest that this method is efficient screening method of Chinese cabbage for resistance to clubroot disease.
본 웹사이트에 게시된 이메일 주소가 전자우편 수집 프로그램이나
그 밖의 기술적 장치를 이용하여 무단으로 수집되는 것을 거부하며,
이를 위반시 정보통신망법에 의해 형사 처벌됨을 유념하시기 바랍니다.
[게시일 2004년 10월 1일]
이용약관
제 1 장 총칙
제 1 조 (목적)
이 이용약관은 KoreaScience 홈페이지(이하 “당 사이트”)에서 제공하는 인터넷 서비스(이하 '서비스')의 가입조건 및 이용에 관한 제반 사항과 기타 필요한 사항을 구체적으로 규정함을 목적으로 합니다.
제 2 조 (용어의 정의)
① "이용자"라 함은 당 사이트에 접속하여 이 약관에 따라 당 사이트가 제공하는 서비스를 받는 회원 및 비회원을
말합니다.
② "회원"이라 함은 서비스를 이용하기 위하여 당 사이트에 개인정보를 제공하여 아이디(ID)와 비밀번호를 부여
받은 자를 말합니다.
③ "회원 아이디(ID)"라 함은 회원의 식별 및 서비스 이용을 위하여 자신이 선정한 문자 및 숫자의 조합을
말합니다.
④ "비밀번호(패스워드)"라 함은 회원이 자신의 비밀보호를 위하여 선정한 문자 및 숫자의 조합을 말합니다.
제 3 조 (이용약관의 효력 및 변경)
① 이 약관은 당 사이트에 게시하거나 기타의 방법으로 회원에게 공지함으로써 효력이 발생합니다.
② 당 사이트는 이 약관을 개정할 경우에 적용일자 및 개정사유를 명시하여 현행 약관과 함께 당 사이트의
초기화면에 그 적용일자 7일 이전부터 적용일자 전일까지 공지합니다. 다만, 회원에게 불리하게 약관내용을
변경하는 경우에는 최소한 30일 이상의 사전 유예기간을 두고 공지합니다. 이 경우 당 사이트는 개정 전
내용과 개정 후 내용을 명확하게 비교하여 이용자가 알기 쉽도록 표시합니다.
제 4 조(약관 외 준칙)
① 이 약관은 당 사이트가 제공하는 서비스에 관한 이용안내와 함께 적용됩니다.
② 이 약관에 명시되지 아니한 사항은 관계법령의 규정이 적용됩니다.
제 2 장 이용계약의 체결
제 5 조 (이용계약의 성립 등)
① 이용계약은 이용고객이 당 사이트가 정한 약관에 「동의합니다」를 선택하고, 당 사이트가 정한
온라인신청양식을 작성하여 서비스 이용을 신청한 후, 당 사이트가 이를 승낙함으로써 성립합니다.
② 제1항의 승낙은 당 사이트가 제공하는 과학기술정보검색, 맞춤정보, 서지정보 등 다른 서비스의 이용승낙을
포함합니다.
제 6 조 (회원가입)
서비스를 이용하고자 하는 고객은 당 사이트에서 정한 회원가입양식에 개인정보를 기재하여 가입을 하여야 합니다.
제 7 조 (개인정보의 보호 및 사용)
당 사이트는 관계법령이 정하는 바에 따라 회원 등록정보를 포함한 회원의 개인정보를 보호하기 위해 노력합니다. 회원 개인정보의 보호 및 사용에 대해서는 관련법령 및 당 사이트의 개인정보 보호정책이 적용됩니다.
제 8 조 (이용 신청의 승낙과 제한)
① 당 사이트는 제6조의 규정에 의한 이용신청고객에 대하여 서비스 이용을 승낙합니다.
② 당 사이트는 아래사항에 해당하는 경우에 대해서 승낙하지 아니 합니다.
- 이용계약 신청서의 내용을 허위로 기재한 경우
- 기타 규정한 제반사항을 위반하며 신청하는 경우
제 9 조 (회원 ID 부여 및 변경 등)
① 당 사이트는 이용고객에 대하여 약관에 정하는 바에 따라 자신이 선정한 회원 ID를 부여합니다.
② 회원 ID는 원칙적으로 변경이 불가하며 부득이한 사유로 인하여 변경 하고자 하는 경우에는 해당 ID를
해지하고 재가입해야 합니다.
③ 기타 회원 개인정보 관리 및 변경 등에 관한 사항은 서비스별 안내에 정하는 바에 의합니다.
제 3 장 계약 당사자의 의무
제 10 조 (KISTI의 의무)
① 당 사이트는 이용고객이 희망한 서비스 제공 개시일에 특별한 사정이 없는 한 서비스를 이용할 수 있도록
하여야 합니다.
② 당 사이트는 개인정보 보호를 위해 보안시스템을 구축하며 개인정보 보호정책을 공시하고 준수합니다.
③ 당 사이트는 회원으로부터 제기되는 의견이나 불만이 정당하다고 객관적으로 인정될 경우에는 적절한 절차를
거쳐 즉시 처리하여야 합니다. 다만, 즉시 처리가 곤란한 경우는 회원에게 그 사유와 처리일정을 통보하여야
합니다.
제 11 조 (회원의 의무)
① 이용자는 회원가입 신청 또는 회원정보 변경 시 실명으로 모든 사항을 사실에 근거하여 작성하여야 하며,
허위 또는 타인의 정보를 등록할 경우 일체의 권리를 주장할 수 없습니다.
② 당 사이트가 관계법령 및 개인정보 보호정책에 의거하여 그 책임을 지는 경우를 제외하고 회원에게 부여된
ID의 비밀번호 관리소홀, 부정사용에 의하여 발생하는 모든 결과에 대한 책임은 회원에게 있습니다.
③ 회원은 당 사이트 및 제 3자의 지적 재산권을 침해해서는 안 됩니다.
제 4 장 서비스의 이용
제 12 조 (서비스 이용 시간)
① 서비스 이용은 당 사이트의 업무상 또는 기술상 특별한 지장이 없는 한 연중무휴, 1일 24시간 운영을
원칙으로 합니다. 단, 당 사이트는 시스템 정기점검, 증설 및 교체를 위해 당 사이트가 정한 날이나 시간에
서비스를 일시 중단할 수 있으며, 예정되어 있는 작업으로 인한 서비스 일시중단은 당 사이트 홈페이지를
통해 사전에 공지합니다.
② 당 사이트는 서비스를 특정범위로 분할하여 각 범위별로 이용가능시간을 별도로 지정할 수 있습니다. 다만
이 경우 그 내용을 공지합니다.
제 13 조 (홈페이지 저작권)
① NDSL에서 제공하는 모든 저작물의 저작권은 원저작자에게 있으며, KISTI는 복제/배포/전송권을 확보하고
있습니다.
② NDSL에서 제공하는 콘텐츠를 상업적 및 기타 영리목적으로 복제/배포/전송할 경우 사전에 KISTI의 허락을
받아야 합니다.
③ NDSL에서 제공하는 콘텐츠를 보도, 비평, 교육, 연구 등을 위하여 정당한 범위 안에서 공정한 관행에
합치되게 인용할 수 있습니다.
④ NDSL에서 제공하는 콘텐츠를 무단 복제, 전송, 배포 기타 저작권법에 위반되는 방법으로 이용할 경우
저작권법 제136조에 따라 5년 이하의 징역 또는 5천만 원 이하의 벌금에 처해질 수 있습니다.
제 14 조 (유료서비스)
① 당 사이트 및 협력기관이 정한 유료서비스(원문복사 등)는 별도로 정해진 바에 따르며, 변경사항은 시행 전에
당 사이트 홈페이지를 통하여 회원에게 공지합니다.
② 유료서비스를 이용하려는 회원은 정해진 요금체계에 따라 요금을 납부해야 합니다.
제 5 장 계약 해지 및 이용 제한
제 15 조 (계약 해지)
회원이 이용계약을 해지하고자 하는 때에는 [가입해지] 메뉴를 이용해 직접 해지해야 합니다.
제 16 조 (서비스 이용제한)
① 당 사이트는 회원이 서비스 이용내용에 있어서 본 약관 제 11조 내용을 위반하거나, 다음 각 호에 해당하는
경우 서비스 이용을 제한할 수 있습니다.
- 2년 이상 서비스를 이용한 적이 없는 경우
- 기타 정상적인 서비스 운영에 방해가 될 경우
② 상기 이용제한 규정에 따라 서비스를 이용하는 회원에게 서비스 이용에 대하여 별도 공지 없이 서비스 이용의
일시정지, 이용계약 해지 할 수 있습니다.
제 17 조 (전자우편주소 수집 금지)
회원은 전자우편주소 추출기 등을 이용하여 전자우편주소를 수집 또는 제3자에게 제공할 수 없습니다.
제 6 장 손해배상 및 기타사항
제 18 조 (손해배상)
당 사이트는 무료로 제공되는 서비스와 관련하여 회원에게 어떠한 손해가 발생하더라도 당 사이트가 고의 또는 과실로 인한 손해발생을 제외하고는 이에 대하여 책임을 부담하지 아니합니다.
제 19 조 (관할 법원)
서비스 이용으로 발생한 분쟁에 대해 소송이 제기되는 경우 민사 소송법상의 관할 법원에 제기합니다.
[부 칙]
1. (시행일) 이 약관은 2016년 9월 5일부터 적용되며, 종전 약관은 본 약관으로 대체되며, 개정된 약관의 적용일 이전 가입자도 개정된 약관의 적용을 받습니다.