• 통합자연과학논문집
• /
• 제1권3호
• /
• pp.230-233
• /
• 2008

A simple and rapid method is described for extending the 5'- or 3'-end genomic sequence of a known partial sequence by only a single round of PCR. This method involves digesting and ligating genomic and plasmid DNAs, and amplifying the 5'-upstream or 3'-end downstream sequence of the known DNA sequence, using two primers, one gene specific and the other plasmid specific. A single round of PCR amplification is sufficient to produce gene-specific bands detectable in gels. By using this approach, 5'-end genomic sequence of the D-amoeba sams gene was extended.

• The Plant Pathology Journal
• /
• 제18권4호
• /
• pp.187-191
• /
• 2002

This paper describes the cloning and sequence analysis of the 5'-terminal region and full-length cDNA production of genomic RNA of Lily symptomless virus (LSV), a Species Of the genus Carlavirus. A sing1e DNA band about 600 bp harboring the 5'-end of genomic RNA of the virus was successfully amplified by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE), and was cloned for nucleotide sequence determination. Sequence analysis of selected RACE cDNA clones revealed that the LSV 5'non-translated region consists of 67 nucleotides long of AT rich stretch followed GC rich from the 5'-end. To produce full-length cDNA products for the viral genomic RNA, a set of LSV-specific primers could be designed based on the obtained sequence in this study and the known sequences of 3'-terminal region for the virus. Full-length cDNA copies of LSV, an 8.4 kb long, were directly amplified by the long-template RT-PCR technique from the purified viral genomic RNA samples. This full-length cDNA copies were analyzed by restriction mapping. The molecules produced in this study can be useful for the production of in vitro infectious cDNA clone, as well as, for the completion of genomic RNA sequence and genome structure for the virus.

• 한국해양공학회지
• /
• 제24권1호
• /
• pp.166-171
• /
• 2010

In this paper, the front-end of a digital receiver with a 25 kHz carrier frequency, 5 kHz symbol rate, and any excess-bandwidth is designed using two basic facts. The first is known as the uniform sampling theorem, which states that the sampled sequence might not suffer from aliasing even if its sampling rate is lower than the Nyquist sampling rate if the analog signal is a bandpass one. The other fact is that if the sampling rate is 4 times the center frequency of the sampled sequence, the front-end processing complexity can be dramatically reduced due to the half of the sampled sequence to be multiplied by zero in the demixing process. Furthermore, the designed front-end is simplified by introducing sub-filters and sub-sampling sequences. The designed front-end is composed of an A/D converter, which takes samples of a bandpass filtered signal at a 20 kHz rate; a serial-to-parallel converter, which converts a sampled bandpass sequence to 4 parallel sub-sample sequences; 4 sub-filter blocks, which act as a frequency shifter and lowpass filter for a complex sequence; 4 synchronized switches; and 2 adders. The designed front-end dramatically reduces the computational complexity by more than 50% for frequency shifting and lowpass filtering operations since a conventional front-end requires a frequency shifting and two lowpass filtering operations to get one lowpass complex sample, while the proposed front-end requires only four filtering operation to get four lowpass complex samples, which is equivalent to one filtering operation for one sample.

• Mycobiology
• /
• 제33권2호
• /
• pp.109-112
• /
• 2005

The internal transcribed spacer (ITS) regions including the 3'-end of 18S rRNA gene, 5.8S rRNA gene and the 5'-end of the 28S rRNA gene of Rhizopus spp. were amplified by PCR and analyzed by DNASIS program. Length polymorphism of these region ranged from 564 bp in R. oryzae to 789bp in R. stolonifer. The length and sequence of 5.8S was very conserved with $154{\sim}155\;bp$. The sequence of ITS2 was more variable than that of ITS1. The base substitution rates were ranged from 0 to 0.6069 per site, and higher rate was found in R. stolonifer. In general, transition was usually more frequent than transversion. On the basis of sequencing results, four groups were clustered with value of 61.9% similarity; R. oryzae, R. micros pores, R. homothallicus, and R. stolonifer groups.

• 미생물학회지
• /
• 제24권3호
• /
• pp.204-210
• /
• 1986

One clone(pANt32) carring tRNA/sup Arg/ gene was selected from Aspergillus total tRNA gene clones. The nucleotide sequences of this tRNA gene were determined by Maxam and Gilbert's chemical cleavage methods. The sequence of this tRNA gene is as follow; 5'GGCCGGCTGCCCAATTGGCAAGGCGTCTGACTACGAATCAGGAGAT TGCAGGTTCGAGCCCTGCGTGGGTCA3'. This sequence conicides with the characteristecs of other eukaryotic tRNA. Some consensus sequences (ACT-TA bow, TATTTT and T-cluster) are found in both 5'-end and 3'-end flanking regions.

• 생명과학회지
• /
• 제7권3호
• /
• pp.167-171
• /
• 1997

번역개시 및 인산화의 조절에 관여하는 RNA와 단백질의 결합 및 인식기작을 연구하기 위해서[$\alpha$^{-32}$P] UMP-labeled HIV Rev-responsive element(RRE) RNA를 이용한 affinity screening에 이해서 Hela ZA-PII cDNA library로부터 이중선RNA결합단백질의 cDNA (RBFII)를 분리하였다. RBFII의 cDNA에 대한 염기서열을 결정하였으며 기존에 연구된 바 있는 RBFII(RBF 또는 TRBP로 보고되었으며 본 연구에서는 RBFII와 구분하기 위해 RBFI으로 명명)과 대부분의 경우 공통적인 ORF를 지니는 것으로 나타났다. 그러나 5’말단에서는 공통적인 ORF 가 RBFI의 경우 21개의 아미노산을 의미하는 63 nt가 Lac-Z의 N-말단에 연결된데 비해서 특이한 46개 아미노기를 의미하는 138nt가 존재함이 밝혀졌다. 5’-말단에 처음 나타나는 ATG 및 부근의 염기서열을 분석해 볼 때 양 cDNA는 5’말단이 완전하지 않은 것으로 사료된다.

• Journal of Microbiology
• /
• 제33권2호
• /
• pp.136-141
• /
• 1995

From a cluster of structural rRNA genes which has previsouly been cloned (Hwang and Kim, in submission; J. Microbiol. Biotechnol.), a 1.0-kb Eco RI fragment of DNA which shows significant homology to the 25S and rRNA s of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was bidirectionally determined using delection series of the DNA fragment. Comparing the resultant 1016-base sequence with sequences in the database, both the 3'end of 25S-rRNA gene and 5S rRNA gene were searched. The 5S rRNA gene is 118-bp in length and is located 158-bp downstream of 3'end of the 25S rRNA gene. IGSI and IGS2 (partial) sequences are also contained in the fragment. Multiple alignment of the 5S rRNA sequences was carried out with 5S rRNA sequences from some members of the subdivision Basidiomycotina obtained from the database. Polygenetic analysis with distance matrix established by Kimura's 2-parameter method and phylogenetic tree by UPGMA method proposed that T. matsutake is closely related to efibulobasidium allbescens. Secondary structure of 5S rRNA was also hypothesized to show similar topology with its generally accepted eukaryotic counterpart.

• Journal of Life Science
• /
• 제9권2호
• /
• pp.9-14
• /
• 1999

Pseudomonas iodinum IFO 3558 adenosine deaminase(ADA) gene was cloned by the polymerase chain reaction and deduced the amino acid sequence of the enzyme. DNA sequence homology of Pseudomonas iodinum IFO 3558 ADA gene was compared to those of E. coli, human and mouse ADA genes. Unambiguous sequence from both strands of pM21 was obtained for the region believed to encode ADA. The sequence included a 804-nucleotide open reading frame, bounded on one end by sense primer and on the other end by two antisense primer. This open reading frame encodes a protein of 268 amino acids having a molecular weight of 29,448. The deduced amino acid sequence shows considerable similarity to those of E. coli, mouse and human ADA. Pseudomonas iodinum IFO 3558 nucleotide sequence shows 98.5% homology with that of the E. coli ADA sequence and 51.7% homology with that of the mouse ADA sequence and 52.5% homology with that of the human ADA sequence. The ADA protein sequence of Pseudomonas iodinum IFO 3558 shows 96.9% homology with that of the E. coli and 40.7% homology with that of the mouse and 41.8% homology with that of the human. The distance between two of the conserved elements, TVHAGE and SL(1)NTDDP has veen exactly conserved at 76 amino acids for all four ADAs. Two of the four conserved sequence elements shared among the four ADAs are also present in the yeast, rat, human (M), and Human(L) AMP deaminase. The SLSTDDP sequence differs only in the conservative substitution of a serine for an asparagine. A conserved cysteine with conserved spacing between these two regions is also found. Thus, sequence analysis of four ADAs and four AMP deaminases revealed the presence of a highly conserved sequence motif, SLN(S)TDDP, a conserved dipeptide, HA, and a conserved cysteine residue.

• 미생물학회지
• /
• 제32권3호
• /
• pp.198-201
• /
• 1994

Lactobacillus casei에 감염하는 bacteriophage J1 게놈의 cohesive end site (cos)의 염기배열을 결정하였다. 또한 환형 cos와 선형 J1 DNA의 왼쪽 말단 염기배열을 비교한 결과 terminase가 절단하는 위치는 다음과 같았다. 5'- GGTCGGCC$\downarrow$ -3' 3'- $\uparrow$CCAGCCGG -5' J1 게놈의 cohesive end는 3' 말단이 돌출되어 있으며 8개의 뉴클레오티드로 이루어져 있고 G+C 함유율이 87.5%이었다. cos 부위는 선형 DNA의 왼쪽 5' 말단 뉴클레오티드의 위치를 +1로 정하였을 때 -33부터 +25까지 대칭이었다. 지금까지 보고된 phage들의 cos 부위 사이에 상동성은 발견되지 않았다.

• Asian-Australasian Journal of Animal Sciences
• /
• 제20권11호
• /
• pp.1636-1650
• /
• 2007

As an initial step toward a better understanding of the genome structure of Korean cattle (Hanwoo breed) and initiation of the framework for genomic research in this bovine, the bacterial artificial chromosome (BAC) end sequencing of 21,024 clones was recently completed. Among these clones, BAC End Sequences (BESs) of 20,158 clones with high quality sequences (Phred score ${\geq}20$, average BES equaled 620 bp and totaled 23,585,814 bp), after editing sequencing results by eliminating vector sequences, were used initially to compare sequence homology with the known bovine chromosomal DNA sequence by using BLASTN analysis. Blast analysis of the BESs against the NCBI Genome database for Bos taurus (Build 2.1) indicated that the BESs from 13,201 clones matched bovine contig sequences with significant blast hits (E<$e^{-40}$), including 7,075 single-end hits and 6,126 paired-end hits. Finally, a total of 5,105 clones of the Korean cattle BAC clones with paired-end hits, including 4,053 clones from the primary analysis and 1,052 clones from the secondary analysis, were mapped to the bovine chromosome with very high accuracy.