DOI QR코드

DOI QR Code

Streptococcus mutans의 전사체 분석과 독활 추출물로부터 활성 성분 분리

Transcriptome Analysis of Streptococcus mutans and Separation of Active Ingredients from the Extract of Aralia continentalis

  • 이현정 (부산대학교 자연과학대학 생명시스템학과) ;
  • 강다영 (부산대학교 자연과학대학 생명시스템학과) ;
  • 이윤채 (부산대학교 자연과학대학 생명시스템학과) ;
  • 김정남 (부산대학교 자연과학대학 생명시스템학과)
  • Hyeon-Jeong Lee (Department of Integrated Biological Science, College of Natural Sciences, Pusan National University) ;
  • Da-Young Kang (Department of Integrated Biological Science, College of Natural Sciences, Pusan National University) ;
  • Yun-Chae Lee (Department of Integrated Biological Science, College of Natural Sciences, Pusan National University) ;
  • Jeong Nam Kim (Department of Integrated Biological Science, College of Natural Sciences, Pusan National University)
  • 투고 : 2023.04.25
  • 심사 : 2023.07.13
  • 발행 : 2023.07.30

초록

식물 천연추출물에서 항균력을 갖는 활성 물질을 분리하고 이를 구강 건강 관리 제품에 사용하려는 연구가 진행되고 있다. 본 연구에서는 유기용매를 사용하여 독활과 우방자로부터 추출한 복합 화합물에 대한 구강 감염균인 Streptococcus mutans의 특정 유전자 발현 변화를 분석하여 항균 기작을 분석하고자 하였다. 전사체 분석 결과, 두 가지 천연추출물에 의해 다양한 대사 및 생리 작용과 연관된 유전자의 발현이 공통적으로 증가하거나 감소하는 것으로 나타났다. 세 가지 유전자(SMU_1584c, SMU_2133c, SMU_921)는 공통적으로 높은 수준으로 발현되었으며, 특히 이 중 SMU_921 (rcrR)은 두 가지 sugar phosphotransferase system (PTS)의 전사 활성자로써 당원의 수송과 생물막 형성에 기여하는 것으로 알려져 있다. 또한, 우방자 추출물에 비해 다수의 유전자 발현 변화에 영향을 미치는 것으로 나타난 독활 추출물의 성분 분석을 진행하였고, 활성 분획의 가스 크로마토그래피-질량분석법(GC-MS)을 통해 두 가지 활성 단일 물질을 동정하였다. 물질 분리 과정에서 여러 유기용매 분획 중 hexane층(ACEH)의 항균 활성이 가장 높게 관찰되었다. 다양종 미생물 군집을 사용한 실험결과, S. mutans에 대한 ACEH의 항균 특이성이 관찰되었으나, 상대적으로 S. sanguinis와 S. gordonii의 생균수도 크게 감소하는 것으로 나타났다. 이러한 결과는 독활 천연추출물의 광범위한 항균 활성을 시사하며, 동정한 단일 물질의 항균 기작을 분석하여 맞춤형 항균 소재 개발에 중요한 기초 자료를 제공할 수 있다.

The research has been conducted on the isolation of antimicrobial compounds from plant natural extracts and their potential application in oral health care products. This study aimed to investigate the antimicrobial mechanism by analyzing the changes in gene expression of Streptococcus mutans, a major oral pathogen, in response to complex compounds extracted from Aralia continentalis and Arctii Semen using organic solvents. Transcriptome analysis (RNA-seq) revealed that both natural extracts commonly upregulated or downregulated the expression of various genes associated with different metabolic and physiological activities. Three genes (SMU_1584c, SMU_2133c, SMU_921), particularly SMU_921 (rcrR), known as a transcription activator of two sugar phosphotransferase systems (PTS) involved in sugar transport and biofilm formation, exhibited consistent high expression levels. Additionally, component analysis of the A. continentalis extract was performed to compare its effects on gene expression changes with the A. Semen extract, and two active compounds were identified through gas chromatography-mass spectrometry (GC-MS) analysis of the active fraction. The n-hexane fraction (ACEH) from the A. continentalis extract exhibited antibacterial specificity against S. mutans, leading to a significant reduction in the viable cell counts of Streptococcus sanguinis and Streptococcus gordonii among the tested multi-species bacterial communities. These findings suggest the broad-spectrum antibacterial activity of the A. continentalis extract and provide essential foundational data for the development of customized antimicrobial materials by elucidating the antibacterial mechanism of the identified active compounds.

키워드

서론

일반적으로 충치로 알려진 치아우식증은 가장 호발하는 구강질환 중 하나이다[18]. 치아우식증은 특정적인 구강 미생물 군집으로부터 합성된 산성 생산물에 의해 치아 표면에 있는 광택층과 질구층이 부식되어 치아가 부서지거나 치아 표면이 깨져 나가는 질환이다[6]. Streptococcus mutans는 이러한 치아우식증을 일으키는 원인 균주 중 하나로 알려져 있으며, 자당(sucrose)과 과당(fructose)을 포함한 다양한 당분을 대사하여 유기산을 생성하여 치아의 부식을 유발한다[4, 14, 15].

S. mutans에 대한 여러 천연물 연구 중, 녹차 추출물이 이 감염균의 생장을 효율적으로 억제하는 것으로 나타났다[3, 7, 19, 21]. 녹차 추출물에는 카테킨(Catechin)과 폴리페놀(Polyphenol)과 같은 다양한 생리활성 성분이 있고, 이러한 성분은 S. mutans의 생장을 억제하고 치아의 미네랄화와 치아상처의 치유에도 도움을 줄 수 있다[3, 19, 21]. 이러한 천연추출물 중, 독활(Aralia continentalis)은 전통적으로 항염, 항균, 해열 등의 효과가 있는 것으로 알려져 있으며[8, 20], 최근 연구에서는 S. mutans의 생장을 저해하고 생물막(biofilm) 형성을 억제하는 효과적인 항균 작용이 보고되었다[11-13]. 독활에서 분리한 화합물에서 continentalic acid과 kaurenoic acid이 검출되었는데, 이들 물질은 다양한 세균에 대한 항균작용을 가지고 있다[10, 11]. 뿌리에서 추출한 continentalic acid는 methicillin-resistant Staphylococcus aureus (MRSA)에 대한 항균작용이 검증되었고[10], kaurenoic acid는 S. mutans의 생물막과 군집 형성을 억제하는 것으로 보고되었다. 특히, kaurenoic acid의 4 μg/ml 정도 이상의 농도에서 S. mutans의 성장이 전혀 관찰되지 않아 항우식 치료제로써 독활 천연추출물의 효과를 입증되었다. 최근에 본 연구팀은 독활과 유사한 항균 효과를 보이는 우방자(Arctii Semen) 추출물에 대한 연구를 보고하였다[13]. 독활 추출물과 유사하게 우방자 추출물은 S. mutans의 성장억제 뿐만 아니라 생물막 형성을 위한 주요 단백질인 glucosyltransferases (GTFs)의 유전자 발현을 감소시켜 생물막 형성을 줄인다는 것으로 분석되었다.

본 연구에서는 구강 감염균인 S. mutans가 이러한 항균 활성을 나타내는 독활과 우방자 천연추출물에 대한 반응으로 유전자 발현이 변화되는 것을 전사체 분석 기법(RNA-seq)을 사용하여 비교 분석하였으며, 천연 추출물의 혼합물에서 항균성을 주로 나타내는 유효 성분을 분리하기 위한 연구도 함께 수행하였다. 또한, 토착종을 포함한 다양종 미생물 환경에서 독활 천연추출물이 S. mutans에 대해 갖는 유효성분의 항균력을 실험해 보았다.

재료 및 방법

사용 균주 및 배양

본 연구에서는 구강 감염균인 Streptococcus mutans UA159 구강내 토착균종인 Streptococcus sanguinis (ATCC 10556), 그리고 Streptococcus gordonii DL-1균주를 BHI (brain heart infusion) 배지(BD Biosciences, New Jersey, USA)를 사용하여 37℃, 5% CO2 환경에서 배양하였다.

전사체 분석

S. mutans의 천연추출물에 반응에 대한 전사체를 분석하기 위해 37℃, 5% CO2 조건으로 18시간 동안 배양한 배양액을 새로운 BHI 배지에 희석(1:100, v/v)하고 흡광도(optical density at 600 nm; O.D. 600)가 0.6이 될 때까지 본 배양한 후, 독활과 우방자 추출물을 최종농도 1,000 μg/ml로 1시간 노출하였다. 배양액을 4,000× g, 15분간 원심 분리하여 상층액을 회수하고, 1 ml의 RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany)로 10분간 처리한 후, 4℃ 환경에서 4,000× g, 10분 동안 원심 분리하여 세포를 회수하였다. Sodium dodecyl sulfate (SDS)를 첨가한 50/10 mM Tris-EDTA buffer에 재현탁한 후, 산성 phenol이 들어 있는 2-ml capping tube에 세포를 옮겨 담고 Bead Beater (Biospec Products, Inc., OK, USA)를 이용하여 파쇄 하였다. 이를 원심 분리하여 RNA가 포함된 상층액을 회수하고, RNeasy Mini Kit (Qiagen, Hilden, Germany)을 사용하여 total RNA를 추출하였다. RNA의 농도는 NanoDrop 2000 (Thermo Fisher Scientific, MA, USA)을 사용하여 측정하였다. 1 μg의 total RNA를 사용하여 cDNA 라이브러리를 제작하고, 이를 Illumina Hiseq 4000 (Macrogen, Seoul, South Korea)을 사용하여 전사체 분석을 진행하였다. 최초 원본 자료(Raw data)는 Galaxy 온라인 버전(https://usegalaxy. org)을 활용하여 S. mutans UA159 reference genome을 기준으로 mapping 하였고, 모듈화되어 있는 FASTQ groomer, Bowtie, StringTie, 및 Cuffmerge를 사용하여 일련의 분석 과정을 진행하였다. 앞선 프로그램에 의해 처리된 데이터에 각 유전자의 기능 주석을 삽입하기 위해 Database for Annotation, Visualization, and Integrated Discovery (DAVID (https://david.ncifcrf.gov/) 프로그램을 사용하였다. 또한, multiple experiment viewer (MeV) (https://webmev.tm4.org/) 프로그램을 이용하여 각 추출물의 처리에 의해 다르게 발현되는 유전자(differentially-expressed genes, DEGs)를 선별하였다.

유효성분 층분리 및 분석

Aralia continentalis는 땅두릅(Aralia cordata)의 변종인 독활로 알려져 있으며, 본 연구의 재료인 건조한 뿌리는 한국식물추출물은행(http://portal.kribb.re.kr/)과 서울 한약 약재상에서 구입하였다. 분쇄한 뿌리의 50 g을 50°C의 1 l의 ethanol에서 1시간 동안 sonication 처리하여 추출하고 상층액을 수집했다. 이 과정을 3회 반복하고, 모든 상등액을 혼합하고 filter paper No. 2 (Advantec Toyo Kaisha, Ltd., Japan)로 여과하였다. 상등액을 회전진공증발기(Eyela, Japan)로 50℃에서 감압 농축하였다. Ethanol 추출물(ACE)은 추출물의 응집을 피하기 위해 10% ethanol에 용해시키고 n-hexane과 물로 분획하였다. n-hexane 분획(ACEH)을 농축하고 silica gel column (6 cm × 40 cm, Merck, Darmstadt, Germany)에 적용한 후, n-hexane/ethyl acetate (5:1, v/v), chloroform, ethyl acetate, 그리고 butanol을 이용하여 층분리를 하였다. 각 chromatography의 분획은 Thin Layer Chromatography (TLC)를 이용하여 전개하여 분석되었다[1]. 각 분획을 TLC Silica gel 60 plate (Merck, Darmstadt, Germany)에 직접 점적하고, plate를 n-hexane/methanol (5:1, v/v)를 포함한 용액에서 전개하고 110℃에서 10분 동안 가열한 후 1% (w/v) N-(1-naphthyl)-ethylenediamine 및 20% (v/v) sulfuric acid를 혼합한 methanol에 침지하여 이동한 시료들을 관찰하였다. 그리고 항균 활성 분획의 성분 분석(GC-MS 분석)은 부경대학교 자율 활용 실험실의 도움을 받아 실시하였다.

다양종미생물의 분포비율 분석

추출물로부터 분리 및 정제한 ACEH 분획의 처리 시, 세 균주(S. mutans, S. sanguinis와 S. gordonii)의 생균수 비율을 측정하기 위해 이전 실험과 동일하게 배양액을 준비하고, 새로운 BHI 배지에 1:100으로 희석하였다. 초기 대수성장기(O.D. 600=0.3)로 배양한 각 배양액을 채취하여 직렬 희석(serial dilution)한 후, 50 μl를 BHI 한천 플레이트에 도말하고 37℃, 5% CO2에서 48시간 동안 배양하였다. 배지에 형성된 집락(colony)의 수를 세어 집락형성단위(colony forming units)를 계산하였다[22].

각 균주의 16S rRNA를 증폭하기 위해 보존된 서열을 기반으로 primer를 제작하였다. S. mutans (FP, GGACACACTGTGCTTGCAC; RP, ACTAGTGATGCGCTTGCATC), S. sanguinis (FP, AGGAGCTTGCTCTTCT; RP, GTCCATCTGGTAGTGATGCAA) 및 S. gordonii (FP, AAAAATTATTCTGTCAGTGGAC; RP, CAAGCAACGGTATAAACTG)의 primer를 사용하였다. Real-time PCR 반응을 위해 genomic DNA는 추출물 ACEH 분획의 처리 전과 후의 혼합 배양액에서 GenElute Bacterial Genomic DNA kit (Sigma, Missouri, USA)를 사용하여 분리하였다. 정량적 PCR 반응은 분리한 3 μl의 genomic DNA에 10 μl의 2× qPCR MasterMix (with EvaGreen, high ROX) (Coregen, Busan, Korea), 1 μM의 Forward-와 Reverse-primer, 그리고 최종 부피가 25 μl이 되도록 증류수를 혼합하여, StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, Massachusetts, USA)을 사용하여 다음 조건에 따라 실시하였다. 먼저 95℃에서 5분간 반응하고 denaturation을 95℃에서 20초, annealing을 55℃에서 30초, extension을 72℃에서 30초를 40회 반복하였다. 이때 실시간 핵산 증폭 결과인 Ct값에 따른 copy number를 환산하기 위해 각 균주로부터 분리한 genomic DNA를 주형(101~108)으로 PCR을 수행하고, Ct 값에 따른 DNA copy number의 표준곡선을 확인한 후 혼합 배양액에서의 핵산의 정량에 적용하였다[9]. 또한, 최초 혼합된 균수의 오차를 보정하기 위해 앞서 실시한 CFU 값을 이용하였다[17].

통계분석

모든 실험은 동일한 과정으로 3번 이상 반복 실행되었다. 실험 결과의 통계분석은 SPSS (statistical package for social science) 프로그램을 이용하여 analysis of variance (ANOVA) 분석법을 적용하였고, least significant difference (LSD)를 사용하여 신뢰수준 95% (p<0.05)에서 통계적 유의성을 검증하였다.

결과 및 고찰

천연추출물의 처리에 따른 Streptococcus mutans의 유전자 발현 변화 분석

선행 연구에서 본 연구자는 구강 병원성 미생물에 대한 직접적인 효과를 입증하기 위하여 순수 분리된 치아 우식증의 원인균인 S. mutans에 대해 100종의 한국자생식물로 부터 추출한 추출물의 생장저해 및 항생물막 활성을 평가하였다[13]. 그 중 5종의 식물추출물(우방자[Arctii Semen], 층꽃나무[Caryopteris incana], 독활[Aralia continentalis], 앉은부채[Symplocarpus renifolius]와 광대나물[Lamium amplexicaule])은 다른 추출물에 비해 상대적으로 높은 성장억제 능력을 보였으며, 특히 독활과 우방자의 추출물은가장 높은 항균 활성을 보였다. 본 연구에서는 항균활성도가 높게 관찰되었던 A. continentalis와 A. Semen 천연추출물의 S. mutans에 대한 항균기작을 규명하기 위해 전사체 분석(RNA-sequencing)을 수행하였다(Fig. 1). 각 해당 식물추출물에 노출되었을 때, S. mutans의 유전자 발현 차이를 분석하였고 그 결과는 표로 요약하였다(Table 1, Table 2). 추출물의 노출에 의한 발현량의 유의미한 차이를 알아보기 위해 두 배 이상의 발현량 차이를 나타내는 유전자만을 선별(p<0.05)하였고, 유전자별 기호, 유전좌위, 배수 변화(log2 value) 및 유전자 주석 정보를 표기하였다. 각 식물추출물 처리에 의해 공통적으로 또는 개별적으로 발현이 증가 또는 감소하는 유전자를 정리하여 벤다이어그램(Venn diagram)으로 나타내고(Fig. 1A), differentially expressed genes (DEGs)의 배수 변화 값을 heatmap으로 가시화하였다(Fig. 1B). 우방자 추출물 처리 시 18개 유전자의 발현이 증가하였고, 반면에 13개 유전자의 발현이 감소하였다. 독활 추출물은 55개 유전자의 발현을 증가시켰고, 38개 유전자의 발현을 감소시켰다. 16s rRNA(SMU_r01, SMU_r04, SMU_r09, SMU_r12, SMU_r15), 연쇄상구균 항원(SMU_1584c, SMU_515), 막 단백질(SMU_2133c), 전사 조절인자(SMU_921) 및 가상 단백질(SMU_1803c)을 암호화하는 10개의 유전자는 두 가지 추출물에 의해 모두 발현량이 증가하였다. 특히, SMU_921(rcrR)은 두 개의 sugar phosphotransferase system (PTS)을 조절하는 전사 활성화 단백질로 작용하며, 다양한 당의 수송 및 생물막 형성과 밀접하게 관련되어 있다[5]. 반면에, 형태 결정 단백질(mreC), 오르니틴 카르바모일-트랜스퍼라제(otcA), 인테그라제(SMU_191c), 디히드로리포아미드 탈수소효소(pdhD), 만니톨-특이적 효소 IIBC 성분(mtlA1), ABC 수송체(SMU_1898, SMU_1899) 및 가상 단백질(SMU_264, SMU_179)을 암호화하는 9개의 유전자는 두 추출물에 의해 모두 공통적으로 감소하였다. 이 중 3개의 유전자(SMU_1584c, SMU_2133c, SMU_921)는 공통적으로 두 추출물 모두에서 가장 높은 발현량을 보여주었다. 이들 유전자는 우방자 추출물에 의해 각각 약 17, 6 및 5배 증가되었으며, 독활 추출물에 의해 각각 약 64, 23 및 9배 발현이 증가되었다. 이러한 결과는 이 세 가지 유전자가 두 식물 추출물에 포함된 활성 항균 성분에 대한 중요한 목표 인자이거나, 활성성분에 대한 S. mutans의 반응인자로 추정할 수 있다. 그러므로 이 유전자의 기능과 역할에 대한 후속 연구가 요구되며, 세포막에 위치하는 것으로 예상되므로 추출물 처리 시 활성물질과 최초 결합 또는 신호를 인지하는 인자들로 제안한다.

SMGHBM_2023_v33n7_538_f0001.png 이미지

Fig. 1. Transcriptome analysis of S. mutans when exposed to plant extracts. Differentially expressed genes (DGEs) in each condition, with a log2 fold change greater than 1 or less than -1 (p<0.05) were identified and grouped. (A) A Venn diagram displays the upregulated genes (top) and downregulated genes (bottom) when cells are treated with each extract, with the number of included genes indicated inside each area. (B) A heatmap shows the log2 value of differentially expressed genes compared to the untreated sample, with hierarchical clustering results represented on the left side of the heatmap. The red or green color on the individual genes indicate increased or decreased gene expression, respectively, corresponding to the fold change.

Table 1. Differentially expressed genes (DEGs) of S. mutans treated with A. Semen extract

SMGHBM_2023_v33n7_538_t0001.png 이미지

Table 2. Differentially expressed genes (DEGs) of S. mutans treated with A. continentalis extract

SMGHBM_2023_v33n7_538_t0002.png 이미지

SMGHBM_2023_v33n7_538_t0003.png 이미지

유기용매를 이용한 유효 활성성분의 분리

선행 연구결과를 바탕으로 S. mutans에 대해 항균효과를 보인 물질인 독활에 대한 물질 분리 및 정제를 진행하였다. 특히, 다른 연구팀에 의한 연구 결과를 보면 독활의 ethanol 추출 분획(ACE)에서 S. mutans에 항균 활성을 나타냈다[12]. 본 연구팀도 추출 단계초기에 보다 다양한 활성 물질을 포함하기 위해 독활 추출의 용매로 ethanol을 사용하였으며, 회전진공농축기를 이용하여 농축 후 보관하였다. 이후 추출물을 순차적으로 hexane, chloroform, ethyl acetate, butanol, water 층으로 분리시키고 분리된 각 층의 항균활성을 관찰하였다(Fig. 2A). 분리된 여러 층 중, hexane fraction에서 S. mutans에 대한 높은 항균 활성을 나타냈다. Hexane층 내의 물질을 분리하기 위하여 silica gel column을 사용하여 극성에 따라 분리하였다. 그 결과 총 19개의 fraction 중 4개의 fraction에서 항균활성을 확인하였다. 유효성분의 농도를 높이기 위해 네 개의 fraction을 혼합한 후, 다시 silica gel column에서 같은 용매(hexane, chloroform, ethyl acetate, butanol, water)를 사용하여 층분리하고 항균 활성을 측정하였다. 위와 같이 hexane 층(ACEH)이 S. mutans에 대한 항균 활성 물질을 함유하는 것으로 확인되었다. 따라서 S. mutans에 대한 항균 활성을 가진 물질은 ACEH에 존재하며, 이를 극성과 물질의 크기에 따라 분리하기 위해 silica gel column을 이용하여 극성에 따라 다시 분리하고 각 분획에 대한 항균 활성을 측정하였다. 그 중 분리된 세 분획(9, 10 및 11번)에서 항균 활성을 관찰하였다(Fig. 2B). 이 세 분획을 W252 column을 이용하여 물질의 크기에 따라 분리한 후, 최종적으로 활성이 나타나는 층을 분리하고 정제하였으며, TLC에 전개하여 확인하였다(Fig. 2C). 총 12개의 분획을 이용하여 항균 활성을 측정한 결과 11번 분획에서 항균 활성이 관찰되었다(Fig. 2D).

SMGHBM_2023_v33n7_538_f0002.png 이미지

Fig. 2. (A) The antibacterial effect of the individual layers was tested by disc diffusion assay. The organic solvents used for chromatography of A. continentalis represent are presented as follows: E for ethanol; Hex for hexane; Chl for chloroform; EA for ethyl acetate; BuOH for butanol. H2O and DMSO were used as a control. (B) A total of 15 fractions were separated from the ACEH layer using silica gel and chromatographed on a Thin Layer Chromatography (TLC) plate. (C) Confirmation of the separation and purification of the active layers using a W252 column was made through TLC. (D) The antibacterial activity of the three fractions was confirmed following separation through a W252 column.

활성 성분의 분석

앞선 chromatography에 의한 분리 단계마다 Ultra Performance Liquid Chromatography (UPLC)를 이용하여 개별 분획의 profiling을 확인하였고, 특히 220 nm 파장에서 분리 및 정제가 진행될수록 유효한 물질들의 peak가 증가하는 것이 명확히 관찰되었다(Fig. 3A). 그러나 다른 파장(250 nm와 280 nm)에서는 이러한 차이가 관찰되지 않았다(결과 생략). Gas Chromatography Mass Spectrometry (GCMS)를 활용한 분석을 통해 ACEH의 11번 분획에 함유된 유효 성분들을 동정하였다(Fig. 3B). 분석 결과, 총 5개의 peak가 확인되었고, 라이브러리와 비교하여 동정된 물질은 pimaric acid와 kaurenoic acid로 각각 57.04%와 26.08%로 높은 함량을 차지하였다. 즉, 독활 천연추출물에 높은 함량으로 함유된 pimaric acid와 kaurenoic acid가 S. mutans에 대한 항균 활성을 가지는 단일 물질로 추정된다. 이 중에서 Kaurenoic acid는 이전 연구 논문에서 S. mutans의 생장 억제와 생물막 형성을 저해하는 효과가 입증되었고[2, 16], 이러한 생물막의 형성 저해는 gtf 유전자의 발현 감소에 의한 것으로 밝혀졌다[11]. 또한, 이러한 두가지 단일 물질은 앞서 언급된 독활 추출물에 의해 발현이 저해된 38개의 유전자(ABC transporters, 세포 형태 결정인자, 등)의 역할 감소로 인해 에너지 대사 및 생장을 저해할 수 있다.

SMGHBM_2023_v33n7_538_f0003.png 이미지

Fig. 3. (A) The substances in each fraction were profiled at a wavelength of 220 nm using Ultra Performance Liquid Chromatography (UPLC). (B) The major substances comprising the fraction with antibacterial activity against S. mutans were identified based on GC-MS spectral matching against a reference database.

다양종 미생물군집에 대한 효과

구강 유해 세균인 S. mutans에 대해 항균 활성을 가지는 ACEH가 다른 구강 세균에 미치는 영향을 파악하기 위하여 S. mutans를 비롯하여 S. sanguinis와 S. gordonii에도 ACEH를 처리하여 각 균의 생균수를 측정하고 비교하였다(Fig. 4). 실험한 모든 균주가 ACEH를 1시간 처리하였을 때 생균수가 감소하였으며, 특히 S. sanguinis와 S. gordonii의 생균수가 S. mutans에 비해 현저히 감소하였다(Fig. 4A). 이를 통해 ACEH가 구강미생물의 생존에 미치는 개별적인 효과를 확인하였으며, 세 개의 균주가 함께 존재할 때 ACEH의 효과를 보기 위하여 균주를 혼합하여 다양종 미생물 환경을 조성하였다. 먼저, 각 균주의 16s rRNA를 암호화하는 유전자에 결합하는 primer를 디자인하였다. 다양종 균주가 있는 혼합물에서 원하는 균주를 동정해야 하므로 합성된 primer가 다른 균주의 유전자들과 결합하지 않는 특이성을 가지는지를 PCR 반응을 통해 확인하였다(Fig. 4B). Mid-exponential phase의 균 배양액을 1:1:1 (v/v)의 비율로 섞은 후 ACEH를 MIC농도인 8 μg/ml로 처리하여 한시간 배양하였으며, 비교군으로 ACEH를 처리하지 않은 혼합 배양액을 사용하였다. 두 혼합 배양액으로부터 genomic DNA를 추출하고, 이를 주형으로 앞서 검증한 primer를 사용하여 정량적 PCR을 통해 혼합 배양액 속의 각 균주의 비율을 확인하였다(Fig. 4C). ACEH를 처리하지 않았을 때, 세 균주의 비율을 동일하게 혼합하기 위해 CFU 측정값을 기준으로 보정값을 산출하고 이를 ACEH를 처리한 혼합 배양액에 대입하여 각 균주들의 copy number를 계산에 사용하였다. 이 값을 백분율로 환산하여 ACEH 처리 전과 후의 균주 비율 변화를 측정하였다. 결과에서 볼 수 있듯이 ACEH를 처리하였을 때, 각 균주의 구성 비율은 각각 96.56%, 3.37%, 그리고 0.07%로 비처리군에 비해 배양액을 구성하는 각 균주의 비율에 변화가 현저하게 관찰되었다. 그러므로, ACEH의 항균력은 S. mutans에 비해 상대적으로 S. sanguinis와 S. gordonii에서 강하게 나타났다.

SMGHBM_2023_v33n7_538_f0004.png 이미지

Fig. 4. (A) After treating the three strains with the ACEH fraction, the number of viable cells was measured by colony-forming units (CFU) assay and compared with the number of viable cells in the absence of ACEH. *, statistical significance was determined by the ANOVA analysis at p<0.05. (B) To measure each strain in the mixed culture, 16s rRNA-specific oligomers were synthesized and confirmed by PCR amplification with S. mutans genomic DNA as a template. (C) The ratio of viable cell counts for each strain in the mixed culture was analyzed in the absence or presence of ACEH.

결론적으로 혼합물인 ACEH는 항균제 대체재로 효과는 있으나, 구강 감염성 세균인 S. mutans에 대한 특이성이 낮았다. 특히, 토착세균의 생균수를 크게 감소시킬 수 있어 전체적인 구강의 건강에 대한 효과 검증은 아직 미비하나, 보다 다양한 구강미생물 생태에서 체계적인 측정을 한다면 이 후보 천연추출물의 효과를 입증할 수 있을 것으로 기대한다. 후속 연구에서는 동정한 단일 물질을 이용하여 인체유래 치태 미생물 생태에 대한 항균 기능을 확인할 것이며, 다른 구강 유해 균주에 대한 항균 활성을 검증하여 실용화 단계를 위한 기초 자료로 활용할 계획이다.

감사의 글

본 연구는 부산대학교 기본연구지원사업(2년)의 지원으로 수행되었음.

The Conflict of Interest Statement

The authors declare that they have no conflicts of interest with the contents of this article.

참고문헌

  1. Baj, T., Sieniawska, E., Ludwiczuk, A., Widelski, J., Kieltyka-Dadasiewicz, A., Skalicka-Wozniak, K. and Glowniak, K. 2017. Thin-layer chromatography-fingerprint, antioxidant activity, and gas chromatography-mass spectrometry profiling of several Origanum L. species. JPC-J. Planar Chromat. 30, 386-391. https://doi.org/10.1556/1006.2017.30.5.7
  2. de Andrade, B. B., Moreira, M. R., Ambrosio, S. R., Furtado, N. A., Cunha, W. R., Heleno, V. C., Silva, A. N., Simao, M. R., da Rocha, E. M., Martins, C. H. and Veneziani, R. C. 2011. Evaluation of ent-kaurenoic acid derivatives for their anticariogenic activity. Nat. Prod. Commun. 6, 777-780.
  3. Farkash, Y., Feldman, M., Ginsburg, I., Steinberg, D. and Shalish, M. 2019. Polyphenols inhibit Candida albicans and Streptococcus mutans biofilm formation. Dent. J. 7, 42.
  4. Forssten, S. D., Bjorklund, M. and Ouwehand, A. C. 2010. Streptococcus mutans, caries and simulation models. Nutrients 2, 290-298. https://doi.org/10.3390/nu2030290
  5. Gong, T., He, X., Chen, J., Tang, B., Zheng, T., Jing, M., Lin, Y., Pan, Y., Ma, Q., Li, Y. and Zhou, X. 2021. Transcriptional profiling reveals the importance of RcrR in the regulation of multiple sugar transportation and biofilm formation in Streptococcus mutans. mSystems 6, e0078821.
  6. Gross, E. L., Beall, C. J., Kutsch, S. R., Firestone, N. D., Leys, E. J. and Griffen, A. L. 2012. Beyond Streptococcus mutans: dental caries onset linked to multiple species by 16S rRNA community analysis. PLoS One 7, e47722.
  7. Han, S., Abiko, Y., Washio, J., Luo, Y., Zhang, L. and Takahashi, N. 2021. Green tea-derived epigallocatechin gallate inhibits acid production and promotes the aggregation of Streptococcus mutans and non-mutans streptococci. Caries Res. 55, 205-214. https://doi.org/10.1159/000515814
  8. Hong, R., Sur, B., Yeom, M., Lee, B., Kim, K. S., Rodriguez, J. P., Lee, S., Kang, K. S., Huh, C. K., Lee, S. C. and Hahm, D. H. 2018. Anti-inflammatory and anti-arthritic effects of the ethanolic extract of Aralia continentalis Kitag. in IL-1β-stimulated human fibroblast-like synoviocytes and rodent models of polyarthritis and nociception. Phytomedicine 38, 45-56. https://doi.org/10.1016/j.phymed.2017.10.016
  9. Huang, R., Zhang, J., Yang, X. F. and Gregory, R. L. 2015. PCR-based multiple species cell counting for in vitro mixed culture. PLoS One 10, e0126628.
  10. Jeong, S. I., Han, W. S., Yun, Y. H. and Kim, K. J. 2006. Continentalic acid from Aralia continentalis shows activity against methicillin-resistant Staphylococcus aureus. Phytother. Res. 20, 511-514. https://doi.org/10.1002/ptr.1894
  11. Jeong, S. I., Kim, B. S., Keum, K. S., Lee, K. H., Kang, S. Y., Park, B. I., Lee, Y. R. and You, Y. O. 2013. Kaurenoic Acid from Aralia continentalis inhibits biofilm formation of Streptococcus mutans. Evid. Based Complement. Alternat. Med. 2013, 160592.
  12. Lee, D. H., Seo, B. R., Kim, H. Y., Gum, G. C., Yu, H. H., You, H. K., Kang, T. H. and You, Y. O. 2011. Inhibitory effect of Aralia continentalis on the cariogenic properties of Streptococcus mutans. J. Ethnopharmacol. 137, 979-984. https://doi.org/10.1016/j.jep.2011.07.015
  13. Lee, Y. C., Cho, S. G., Kim, S. W. and Kim, J. N. 2019. Anticariogenic potential of Korean native plant extracts against Streptococcus mutans. Planta Med. 85, 1242-1252. https://doi.org/10.1055/a-1013-1364
  14. Lemos, J. A., Palmer, S. R., Zeng, L., Wen, Z. T., Kajfasz, J. K., Freires, I. A., Abranches, J. and Brady, L. J. 2019. The Biology of Streptococcus mutans. Microbiol. Spectr. 7, 10.
  15. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50, 353-380. https://doi.org/10.1128/mr.50.4.353-380.1986
  16. Moreira, M. R., Souza, A. B., Soares, S., Bianchi, T. C., de Souza Eugenio, D., Lemes, D. C., Martins, C. H., da Silva Moraes, T., Tavares, D. C., Ferreira, N. H., Ambrosio, S. R. and Veneziani, R. C. 2016. ent-Kaurenoic acid-rich extract from Mikania glomerata: In vitro activity against bacteria responsible for dental caries. Fitoterapia 112, 211-216. https://doi.org/10.1016/j.fitote.2016.06.007
  17. Nadkarni, M. A., Martin, F. E., Jacques, N. A. and Hunter, N. 2002. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology (Reading) 148, 257-266. https://doi.org/10.1099/00221287-148-1-257
  18. Pitts, N. B., Zero, D. T., Marsh, P. D., Ekstrand, K., Weintraub, J. A., Ramos-Gomez, F., Tagami, J., Twetman, S., Tsakos, G. and Ismail, A. 2017. Dental caries. Nat. Rev. Dis. Primers 3, 17030.
  19. Schneider-Rayman, M., Steinberg, D., Sionov, R. V., Friedman, M. and Shalish, M. 2021. Effect of epigallocatechin gallate on dental biofilm of Streptococcus mutans: An in vitro study. BMC Oral Health 21, 447.
  20. Woo, Y. M., Kim, O. J., Jo, E. S., Kim, S. J., Lee, Y. H., Ahn, M. Y., Lee, S. H., Ha, J. M. and Kim, A. 2019. Anti-inflammatory effects of the combined extracts of Achyranthes japonica nakai and Aralia continentalis kitagawa in vitro and in vivo. Data Brief 25, 104088.
  21. Wu, C. Y., Su, T. Y., Wang, M. Y., Yang, S. F., Mar, K. and Hung, S. L. 2018. Inhibitory effects of tea catechin epigallocatechin-3-gallate against biofilms formed from Streptococcus mutans and a probiotic lactobacillus strain. Arch. Oral Biol. 94, 69-77. https://doi.org/10.1016/j.archoralbio.2018.06.019
  22. Zhang, C., Xin, Y., Wang, Y., Guo, T., Lu, S. and Kong, J. 2015. Identification of a novel dye-decolorizing peroxidase, EfeB, translocated by a twin-arginine translocation system in Streptococcus thermophilus CGMCC 7.179. Appl. Environ. Microbiol. 81, 6108-6119. https://doi.org/10.1128/AEM.01300-15